Яровинский олег биография: Спортивный директор «Рубина» – фанат экстремального отдыха. После его монолога вам тоже захочется в поход

Биография

Содержание

«Лучший скаут ЦСКА — человек, который никогда не играл в футбол» — Пресса о ПФК ЦСКА — Новости — официальный сайт ПФК ЦСКА

Селекционный отдел ЦСКА считается лучшим в Премьер-лиге. Чтобы понять, как клубу удается выгоднее всех продавать и эффективнее всех покупать, еженедельник «Футбол» встретился со спортивным директором армейцев Олегом Яровинским, который рассказал о том, как правильно искать новичков, может ли обычный человек стать скаутом и почему для ЦСКА невозможен путь «Порту» и «Удинезе».

Янчик, Думбия

— Весной ЦСКА было тяжело без Думбия. Смысл был отпускать Нецида? 
— Это было общим решением. Тем более мы взяли Страндберга, у нас есть Панченко, Муса. Держать кого-то для количества — не вариант. К тому же Томаш был травмирован. Да и полгода для игрока — огромный срок. За него можно перейти в «Реал», а можно закончить карьеру в коллективе физкультуры. Мы это учитывали. Но расстались без проблем. Не секрет, что ЦСКА со всеми остается в хороших отношениях.

— Только с Янчиком* были проблемы. 
— Янчик вел себя весьма странно. Он просто исчезал из футбола, потом возвращался с какими-то собственными мыслями и претензиями.

— Евгений Гинер рассказывал, что в ЦСКА есть список игроков на каждую позицию, который постоянно находится в ротации. Под какими номерами в нем шли Страндберг и Алиев? 
— У нас нет драфта, как в НХЛ. Игрок может сегодня лучше выступить, завтра хуже, поэтому мы не переставляем их местами. Страндберг и Алиев в принципе значились в списках молодых нападающих. Это совпадение, что они оба оказались из Швеции, потому что были и другие ребята. Турок, например.

— «Молодых нападающих» — то есть для молодых есть отдельный список? 
— Нет, список единый, просто за молодыми ребятами мы следим еще и по соревнованиям U-20, U-21, и, в тот момент когда они будут готовы, мы можем их приобрести.

Хотя Алиев и Страндберг – это люди на будущее, на долгосрочную перспективу. И решение об их приобретении было принято вне зависимости от ухода Думбия.

— То есть ничего страшного, что Алиев сейчас за дубль играет? 
— Более того, он и должен за дубль играть и развиваться там. Никто его не торопит.

Селекция, бриллианты

— Расскажите, как вы оказались в футболе? 
— Пришел по объявлению. Юрий Белоус в 2003 году — я тогда был студентом 3-го курса факультета журналистики МГИМО — написал в газете «Спорт-Экспресс», что футбольный клуб «Торпедо-Металлург» набирает менеджеров в международный отдел. Я откликнулся.

— И сразу стали селекционером? 
— Ни о какой селекции изначально речи не шло, ею занимались уважаемые личности. В селекционный отдел попал года через два, причем очень помог Леонид Слуцкий, который тогда работал тренером дубля. Он много времени проводил с молодежью — Белоус набрал абсолютно новую команду менеджеров, — объяснял разные нюансы.

Как и Сергей Шустиков, кстати. Просмотр игроков – это ведь такая вещь, которой можно научиться. В том же ЦСКА один из лучших скаутов — человек, который профессионально в футбол не играл.

— Что было после «Металлурга»? 
— В нем я проработал до 2008 года, пока на сезон не ушел в «Крылья». Дальше занимался агентской деятельностью, был директором российского офиса большого международного агентства «Спорт Инвест», которое заключало сделки по всей Европе. Потом получил приглашение из ЦСКА.

— Из чего состоит стандартный день спортивного директора ЦСКА? 
— Большое количество времени посвящено работе с ДЮСШ. Поэтому я стараюсь приходить на тренерские советы, слушать, как тренеры обсуждают спортивные вопросы. Чтобы, в том числе, поучиться. Там обсуждаются темы детского футбола, которыми нужно владеть. Смотрю много разного футбола. Плюс есть масса встреч с агентами, представителями других клубов, вопросы продажи и покупки молодых игроков. То есть стандартного распорядка нет.

Но каждый день много встреч и футбола.

— Часто бываете в разъездах? 
— Если брать стандартный набор командировок, который есть в селекционном штабе, то он связан с ДЮСШ. Это поездки на разные турниры. Мы всегда стараемся как минимум одного представителя отправить туда, чтобы он посмотрел наших ребят на уровне европейских команд. Плюс периодически летаю с основным составом. Ну и в командировки за рубеж.

— Как происходит поиск игроков? Вы видите крутого футболиста по ТВ, консультируетесь с руководством и едете смотреть на него вживую? 
— Объясню на примере. Вы приходите в педагогический институт и смотрите там три факультета девушек. Посмотрели, отобрали себе и начинаете следить за этим ограниченным кругом. Так и мы. Знаем, что есть условно в Бельгии или Голландии команда, которая активно подтягивает молодежь. Мы без привязки к конкретному человеку смотрим ее матчи. Вдруг кто-то находится – смотрим глубже. Нравится. Начинаем вести. Еще много смотрим превентивно — юношеские, молодежные соревнования.

Не с прицелом на одного игрока, а вообще. Составляем списки, по ним потом кого-то ведем. Любого игрока мы смотрим несколько раз, прорабатываем, потом вступаем в переговоры.

— Когда настает этот момент? 
— Зависит от подхода. Есть позиции, которые требуют усиления в данный конкретный период, есть – которые в перспективе. Тот же самый Витиньо*, которого сейчас как только не склоняют, был человеком, появившимся в списке неожиданно, потому что сыграл не так много матчей, но как модель, подобного плана игрока клуб хотел купить давно. И было несколько кандидатур.

— Как вы определяете, какие чемпионат и клуб смотреть? 
— Во-первых, селекционеры смотрят и детские турниры — это с 8 утра до 9 вечера, когда перед тобой огромное количество детей, а ты перекусываешь бутербродами с чаем. Если говорить о большом футболе, то это все ведущие лиги: Голландии, Бельгии, Германии. Но опять же нужно понимать, кого мы смотрим. Бесполезно говорить: «Давайте купим Гетце».

— То есть вы ищете того, о ком никто не знает? 
— Такого не бывает. При современном уровне развития технологий невозможно усмотреть кого-то в одно лицо. Если человек считает, что он может привезти со двора такой бриллиант, что он сразу попадет в основной состав ЦСКА, это значит, что он не отдает себе отчета об уровне РФПЛ. Попасть в Премьер-лигу со двора нереально, футболист уже должен быть определенного уровня. А если он определенного уровня, значит, о нем знает много народу. И вопрос тут уже в другом. Если раньше большие деньги стоила информация – о том, кто и где играет, то сейчас самое сложное — это коммуникация. То есть понимание, как дойти до человека, как правильно действовать и как купить его с наименьшими затратами для клуба. Этим мы и стараемся заниматься.

— Получается, современная селекция — это больше переговоры, чем поиск? 
— Конечно. Сейчас нельзя представить ситуацию, что ты кого-то нашел в дебрях, привез его, сам поставил в состав, он заиграл, забил 50 мячей — все, ты красавец. Такого не бывает.

Галицкий, кот в мешке

— Скаутом может стать любой? Сергей Галицкий* рассказывал в интервью «СЭ», как нашел игрока, смотря футбол на беговой дорожке.
— Существует огромное количество баек, как кто-то кого-то нашел. Если брать конкретно Сергея Галицкого, я не знаю эту историю, но постараюсь проанализировать. Он предприниматель высокого уровня. Чтобы им стать, у него наверняка есть своя система, по которой он строит бизнес. Поэтому что он сделал? Увидел человека, который ему чем-то приглянулся, понял, что этот человек выступает на высоком уровне, сыграл там определенное количество матчей. То есть Галицкий, как системный человек, минимизировал возможность ошибки и попросил свою селекционную службу полностью игрока проработать. Они это сделали. Так что если ты системный человек, понимаешь, как происходят процессы, то, да, ты вполне можешь быть скаутом.

— В детском футболе возможно откопать неизвестный талант? 
— Если совсем углубляться в детский спорт, то, наверное, можно. Хотя возьмем Александра Головина, который сейчас является игроком основного состава ЦСКА. Его высмотрел один скаут, потом, чтобы уговорить перейти в клуб, директор академии и еще один человек летали к нему. Но его уровень, несмотря на то что он был достаточно юным, был понятен. Просто не все в него верили, а в ЦСКА поверили. Но такого, чтобы его никто не знал и не видел, не было. Он чуть ли не через турнир получал приз лучшего футболиста по своему возрасту.

— Какими программами пользуются скауты? 
— Wyscout и Instat. Также у нас есть много связных и источников из разных стран. Они не числятся в клубе, но это наши товарищи, агенты, спортивные директора. Мы все контачим, обмениваемся информацией.

— В контрактах скаутов прописаны бонусы за удачные трансферы и ответственность за провал? 
— Что такое провал? Провал — это привезти игрока, у которого одна нога деревянная. А так возможна как удача, так и неудача. В этом вся соль селекции.

Хотя чудес не бывает. Если проанализировать рынок молодых футболистов в Западной Европе, которые переходят из маленькой команды в среднюю, а потом из средней — в топ, то сумма, которую средняя команда заплатила маленькой, будет измеряться уже сотнями тысяч евро. Идиотов нигде нет — настоящий талант видно всегда, и за него попросят деньги. Но можно грамотно вести переговоры и минимизировать сумму выплаты. Дело – в процессе убеждения.

— Если скаутинг — это про переговоры, а не про поиск, почему в «Удинезе» постоянно находят крутых игроков, которых никто не знал? 
— «Удинезе» — это клуб, который не боится рисковать большими деньгами даже за самых юных игроков. Потому что он работает за счет оборота. Они могут заплатить три раза по 300 тысяч евро за 15-летних футболистов и потом на одном из них заработать 50 млн. Но для этого нужно иметь определенную заточку. ЦСКА не может выполнять роль «Удинезе», потому что нам нужно еще бороться за титулы и играть в Лиге чемпионов.

«Удинезе» часто совмещает приятное с полезным, но они много ошибаются. Просто об их ошибках мы не знаем, а удачи видим.

— То есть это просто раскрученная история и итальянские скауты не такие крутые? 
— Они крутые тем, что от момента, когда они кого-то увидели, до момента, когда об этом узнал президент клуба, проходит минимальное количество времени. И решения принимаются очень быстро. Та же история с «Порту»*. Они могут спокойно за молодого заплатить 6 млн евро, потом продадут его за 30. Но эти 6 млн очень часто отдаются за кота в мешке. И у них есть ошибки. Просто это такая модель бизнеса.

— При этом «Порту» борется за титулы. 
— Да, но, базируясь в Португалии, они могут легко охватить бразильский и африканский рынки молодежи. Переезжая в Португалию, ребята попадают в знакомую среду — там тепло, там море, там менталитет, который позволяет таланты не губить. В нашей стране приезд иностранцев в возрасте 14–15 лет затруднен.

— Расскажите про самые тяжелые переговоры.  
— Каждый трансфер индивидуален, поэтому везде были свои ситуации. Легких переговоров не бывает вообще. Потому что нужно свести воедино позиции продавца, покупателя, игрока, агента, хотя в ЦСКА мы стараемся минимизировать их участие и общаемся с клубами напрямую. Но бывают ситуации, когда нам помогают другие люди, которые имеют влияние на клуб.

— Был ли неизвестный игрок, которого вы хотели приобрести, но не сделали этого, а он стал звездой? 
— В «Москву» мы хотели купить Анхеля Ди Марию. Даже почти купили. Сидели, общались, он был согласен, но «Бенфика» опередила. Вели переговоры по Йосси Бенаюну еще до его перехода в «Челси». Тогда он играл в «Расинге» из Сантандера. По Ди Марии, кстати, мы разговаривали летом, а осенью была возможность купить его еще дешевле. При этом он стоил не десятки тысяч долларов, а больше миллиона. И был котом в мешке, из которого неизвестно что получилось бы. То есть снова ситуация, о которой я говорил: игрока, никакую не звезду, ведут несколько клубов, при этом он уже стоит серьезных деньг. Но за счет быстрой работы можно всех опередить и его забрать.

— Белоус рассказывал, что «Москву» мог возглавить Дель Боске. 
— На каком-то этапе был Зденек Земан. До Олега Блохина — Михайличенко, пара итальянских тренеров. Мы с ними встречались, общались. Про некоторых мне не хотелось бы говорить, потому что люди тогда имели работу и параллельно разговаривали с нами. Вдруг решат, что они сейчас работают и тоже на стороне ведут переговоры.

— Часто игроки просили заоблачные суммы? 
— Постоянно. Например, вели переговоры с Фарфаном*, и он запросил такие деньги, что стало дурно. Я думаю, даже «Зенит» и «Газпром» вздрогнули бы.

— Сталкивались со странными увлечениями игроков? 
— Был один иностранец — не буду называть имя, — увлекался такой вещью: на специальном полигоне машины разгоняются, и он должен от них уворачиваться. Когда об этом узнал, подумал, что утка. Оказалось правдой.

— Часто звонят сумасшедшие агенты? 
— Вообще, сумасшедшие постоянно звонят в клубы. Самые частые звонки связаны с тем, что человек играет на первенство области, ему 27–28 лет, но он понял, что хочет стать профессиональным футболистом, и требует, чтобы его пригласили на просмотр в основной состав. На вопрос «Думаете ли вы, что соответствуете нашему уровню?», даже не сомневаясь, отвечает утвердительно. Каждый день такое происходит. 

Килиманджаро, «Дорога костей»

— Леонид Слуцкий не скрывает, что вы дружите и вместе проводите отпуск. Самые популярные направления? 
— У нас сложилась горнолыжная тусовка, куда входят его брат с семьей, его ребенок, наш общий друг с двумя детьми и я с женой и ребенком. Мы уже много лет каждую зиму выезжаем кататься на лыжах. Плюс у нас есть детская хоккейная команда: зимой снимаем коробки и практически каждые выходные устраиваем детский хоккей.

— Забавную историю, связанную со Слуцким, помните? 
— Помню историю с его сыном. Приехали в горы, вышли на склон, его сын сказал, что уже сто раз катался на горных лыжах, и мы поехали. Оказалось, что он немного переоценил свои возможности, и мы кубарем вдвоем летели с горы. Летели долго.

— У вас и кроме горных лыж есть интересные хобби. 
— Началось с детства. Активно увлекался скалолазанием, ходил с отцом на охоту, состоял в скаутской организации, которая занималась походами и приключениями. А тема с Севером появилась после экспедиции на парусном судне. Мы ходили вокруг Шпицбергена. Мне настолько понравилось, что я заболел Севером, и все это вылилось в то, что я вошел в состав дайверского клуба при ЦСК ВМФ, с которым много лет путешествую.

— Только по Северу? 
— Да. У каждого дайвера есть такой дайвбук, и если мой посмотреть, то это выглядит забавно, потому что мой первый дайв и крайний — только там. Я ни разу не нырял в теплой воде и даже не тянет.

— На дне попадаются крутые объекты? 
—У нас был большой проект — обнаружили двигатель времен Великой Отечественной войны от самолета МБР-2*. Это легендарный самолет, он считается отцом-основателем авиации Северного флота. И мы решили этот двигатель поднять, для чего организовали экспедицию по подъему. Вытащили и сдали в музей. Там нам были очень благодарны, для них это ценный экспонат. Они даже нашли фамилии членов экипажа, который ушел в боевой вылет, — все спаслись. Я, правда, там был больше на подхвате — опытные водолазы работали, а я не мешал.

— Ходили по затонувшим кораблям? 
— Только плавал вокруг них. Потому что любое погружение на рэки — так их называют в дайверской среде — это довольно опасное мероприятие. Там очень много частей, за которые можно зацепиться. Плюс мы погружаемся в сухом костюме, и если его порвать под водой, то будет плохо. Еще сильное течение, большая глубина, вода всего два градуса — в общем, ходить по кораблю можно, освоив так называемую специальность — рэк-дайвинг.

— Максимальная глубина погружения? 
— Любительский дайвинг разрешен на глубине не ниже 18 метров, но были обстоятельства, что мне пришлось погрузиться на 30. Вверх поднимался на 6 тысяч метров.

— Это какая же гора? 
— Килиманджаро*. Мой первый опыт восхождения на сложную вершину, и я решил, что нужно идти сложным маршрутом, сам нес рюкзак, хотя есть группа из местных, которые помогают. Потом об этом сильно жалел. Потому что колбасит там как следует. И горная болезнь начинается, и все что угодно. А после 6 тысяч метров в горах вообще умирают все. Начинается отмирание клеток мозга. Вопрос только в том, насколько хороши твои физическая подготовка и природные данные. Кто-то выдерживает два дня, кто-то неделю, а кто-то месяц. Вот чтобы не попасть в число тех, кому осталось два дня, нужно долго готовиться. Поэтому я больше люблю невысокие трекинговые маршруты в Грузии, на Алтае, где можно просто пройтись и получить удовольствие. А терять здоровье, чтобы потом повесить медаль и хвастаться… Зачем?

— Видели в горах мумифицированные трупы? 
— Я все-таки не Федор Конюхов, который рассказывает, что идет, а вокруг люди падают, как столбы, десятками. Но помню случаи, как некоторых одолевала горная болезнь. Они очень странно себя вели. Приходилось их держать, чтобы травму себе не нанесли.

— Расскажите про путешествие на мотоциклах. 
— На Колыме есть знаменитая «Дорога костей», ее строили заключенные ГУЛАГа. Сейчас она заброшенная, потому что из Магадана в Якутск ведет новая трасса, но в мотосреде уважаемая. В итоге мы с ребятами год эту тему прорабатывали, скооперировались с новозеландцами, чехом и сделали маршрут. Но без помощи местных ничего бы не получилось — они нам предоставили автомобили поддержки, в том числе КАМАЗ для форсирования рек.

— Долго ехали? 
— Две недели, причем километров пятьсот — по полнейшему бездорожью. Жили в палатках – там ведь людей вообще нет. Попадались, конечно, населенные пункты, но в лесу как-то приятнее, хотя там медведи бродят. Потому что некоторые города производят удручающее впечатление. Например, заброшенный Кадыкчан. Там жили 10 тысяч человек, но в начале 1990-х они оттуда эвакуировались, оставив все как есть. Мы в этом городе погуляли: жутковатое зрелище. Скрипящие двери, куклы лежат… В общем, нервно сжимали карабины в руках.

— Бывало, что медведь рядом пробегал? 
— Когда был ребенком, в Новгородской области выбежала медведица. Август, стрелять нельзя, а она в пяти метрах оказалась. Обошлось, потому что с дороги свернула. Но страху натерпелся серьезно. Самое страшное, что было слышно, как клокочут ее внутренности. Еще однажды в Якутских горах нас отрезало от основных сил. Забросили туда на вертолете, мы поохотились. И остановились в зимовье оленеводов — это такая общая избушка, которую они используют, если застряли в горах. В этот момент неожиданно пошел снег, и вертолет не мог нас забрать. А мы пошли практически без провизии, потому что план был, что через полтора дня нас эвакуируют обратно.

— Как выживали? 
— Пять дней питались тем, что добывали охотой. Собирали бруснику, варили из нее морс. В страшной цене были чай, сигареты. Но самая главная опасность была в том, что начинало холодать, и эвен, который с нами был, сказал, что, если через день вертолета не будет, нужно оттуда уходить, иначе мы замерзнем. А уходить нужно в стадо, потому что ближайшее жилье было километрах в ста пятидесяти — это несколько дней пути по горам с необходимостью вплавь форсировать реки. Это при нулевой температуре. Но если бы мы ушли в стадо, нас было бы вообще нереально найти, потому что оно постоянно мигрирует, местные живут там по нескольку месяцев. Мы верили, что вертолет прилетит, ждали, в итоге все хорошо закончилось.

— Путешествуете в любое время года? 
— Да, зимой вот ходил в экспедицию на собачьих упряжках по Байкалу. Километров 300 проехал. Когда собаки бегут, кажется, что медленно, потому что всегда в одном темпе. В какой-то момент я решил сфотографировать упряжку сбоку и спрыгнул с нее. И в этот момент понял, что совершил ошибку. Собак, если они вышли на маршрут, невозможно остановить. Только если тормоз на нартах нажать, который вгрызается в лед. Или пока они сами не решат остановиться. В итоге где-то на протяжении сорока минут я гнался за этой упряжкой в зимней одежде — унтах, шапке меховой, от меня пар валил. На рывке почти догонял, чуть-чуть не хватало, снова отставал. Но каким-то чудом смог зацепиться.

— Тяжело с собаками? 
— В тяжелые моменты нужно спрыгивать, толкать, нарты двигать. И если ты помогал им, на привале они подойдут и выкажут уважение. А если ехал, как мешок, и курил бамбук, то у них и отношение будет соответствующее.

Александр Головин

«Рубин» расстается с лидерами команды — Реальное время

Чем обернутся для казанцев потери Старфельта и Макарова в новом сезоне и не скажется ли бизнес-стратегия на результатах?

Новый сезон РПЛ уже стартовал, но команды продолжают трансферную кампанию, которая в России длится аж до 7 сентября. Казанский «Рубин» этим летом уже продал игроков на кругленькую сумму, расставшись с лидерами команды — шведским защитником Карлом Старфельтом и Денисом Макаровым, главной пушкой российского чемпионата. Ввиду участия казанцев в еврокубках в нынешнем сезоне встает вопрос, как справится команда и тренерский штаб с потерей двух значимых футболистов. Кем заменят Старфельта? Как распорядятся в клубе деньгами, заработанными на продаже лидеров, и сможет ли Слуцкий балансировать между необходимостью зарабатывать клубу и продолжать расти как команда? Ответы на эти и другие вопросы — в материале спортивной редакции «Реального времени».

Старфельт отправился в Шотландию и троекратно окупил затраты «Рубина»

С приходом Леонида Слуцкого и спортивного директора Олега Яровинского казанский «Рубин» взял курс на омоложение состава, а заодно и новую модель трансферной политики. Клуб старается брать недорогих игроков и впоследствии перепродавать их. Рынки для поиска потенциальных новичков выбирались самые разнообразные — от Швеции до США. Казанцы укрепились качественными исполнителями в надежде на то, что через какое-то время их можно будет продать в другие лиги, пополнив клубный бюджет, в идеале еще и получить прибыль.

Стратегия стартовала с 2019 года и в 2021 начала давать первые плоды. Карл Старфельт, шведский защитник, перешедший из «Гетеборга» в 2019 году за миллион евро, летом 2021 был продан шотландскому «Селтику» за 5 миллионов. «Рубин» заплатил шведам еще миллион бонусом, однако чистая прибыль казанцев составила 3 миллиона. Старфельт показал себя в Казани и отправился покорять Туманный Альбион.

Поисками замены «Рубин» занимался недолго, и очевидно, что это приобретение рассматривалось еще до официального перехода Старфельта в «Селтик» — команду уже пополнил защитник сборной Туниса Монтассар Тальби. Спортивный директор итальянского «Беневенто» Паскуале Фоджа уже подтвердил факт договоренности между командами. Тальби последние три сезона выступал в чемпионате Турции за клуб «Ризерспор» и бесплатно присоединился к «Беневенто» летом 2021 года. Стоимость Тальби оценивается в районе миллиона евро. Нужно отдать должное итальянскому клубу: бесплатно подписать игрока и сразу продать его другой команде — весьма выгодная трансферная политика.

Но станет ли он достойным сменщиком шведского лидера в «Рубине», покажет сезон.

Тальби последние три сезона выступал в чемпионате Турции за клуб «Ризерспор» и бесплатно присоединился к «Беневенто» летом 2021 года. Фото instagram.com/montassartalbi

Путь Макарова. Из ФНЛ — в сборную и «Динамо». Потеря ли это для «Рубина?

Переход Дениса Макарова довольно надежный немецкий портал Transfermarkt оценивает в 7,5 миллиона евро, СМИ же дают цифру в 10 миллионов. Но в любом случае деньги за Дениса заплачены серьезные, и пока это главный трансферный успех казанцев.

Полузащитник пополнил состав «Рубина» зимой 2020 года, перейдя из нижнекамского «Нефтехимика» за 700 тысяч евро. Уже через полтора сезона Денис отправился покорять столицу в строящийся проект «бело-голубых», а два татарстанских клуба выручили хорошие деньги за талантливого игрока. «Нефтехимик» по договоренности между клубами получит 40% от суммы трансфера Макарова, а это, по разным источникам, 4 миллиона евро. Для команды ФНЛ такие цифры — просто космос.

За год с небольшим Денис Макаров дорос от игрока ФНЛ до уровня сборной и трансфера в несколько миллионов евро, а «Рубин» показал, как можно проворачивать внутрироссийские переходы за большие деньги.

Да, не последнюю роль здесь сыграл лимит на легионеров: без него вряд ли такой трансфер обошелся бы в 10 миллионов. Но в любом случае в «Рубине» при новом спортивном директоре демонстрируют другим клубам РПЛ, как можно зарабатывать на перспективных игроках с внутрироссийского рынка.

Купив Старфельта и Макарова на сумму в 1,7 миллиона, «Рубин» окупился в несколько раз. При этом Макаров в нынешнем сезоне не выходил в стартовом составе казанцев, сыграв лишь 8 минут в игре со «Спартаком».

В интервью «Спорт-Экспресс» Олег Яровинский сообщил, что связано это было с функциональной готовностью: «Да, Макаров начал сезон запасным, потому что больше всех отдыхал после сборной. Плюс у него не было отпуска после сезона. Это никого не должно вводить в заблуждение. Он не выходил в старте, потому что не был до конца готов функционально». Но и факт того, что клуб был готов к продаже полузащитника, спортивный директор команды отрицать не стал.

Купив Старфельта и Макарова на сумму в 1,7 миллиона, «Рубин» окупился в несколько раз. Фото rubin-kazan.ru

Новая экономическая модель команды работает. Но болельщики ждут прогресса в игре, а не на счетах

Оформив две сделки в летнее трансферное окно, «Рубин» заработал около 9 миллионов евро. Если смотреть траты на покупку игроков за последние три трансферных окна, то купили игроков на сумму в 13 миллионов, то есть Старфельт и Макаров почти окупили затраты своего уже бывшего клуба за целый год.

В «Рубине» готовы к продаже любого из лидеров команды, ведь если игрок успешно выступает и прогрессирует, то его переход в более сильный чемпионат выглядит логичным исходом. А если клуб еще и зарабатывает на этом, то в плюсе оказываются все стороны, как и произошло в ситуации со Старфельтом и Макаровым.

Другой вопрос: это ли самоцель? Для поклонников казанской команды выгодные сделки — вещь второстепенная. Болельщику важен результат и еврокубки куда выше новой, но мало кому интересной Лиги конференций. Макаров сыграл важную роль в прошлом сезоне, вытянул победу над «Зенитом», которая стала ключевой в итоговом четвертом месте. Отсутствие такой «палочки-выручалочки», игрока, который может оттянуть внимание с Хвичи на другой фланг, накрутить защитников и забить с острого угла, может сыграть важнейшую роль в наборе очков.

В «Рубине» заявляют о том, что хотят двигаться дальше и замахнуться на нечто большее, чем попадание в четверку. На трансферном рынке мы пока видим шаг вперед и два назад. Не стоит забывать, что «Рубин» — это не только бизнес, это еще и команда, за которую болеют и хотят от нее прогресса на поле, а не на счетах клуба.

Разговоров велось много, но на деле Хвича по-прежнему в команде. Фото rubin-kazan.ru

Эпопея с уходом Хвичи затягивается. Но трансфер неизбежен, это лишь вопрос времени

Продажа игроков — неотъемлемая часть футбольного бизнеса, но в Казани летом 2021-го ожидали ухода другого игрока, а именно — Хвичи Кварацхелии. Грузинский футболист — главный актив «Рубина», и интерес к нему имеют многие европейские клубы, да и сам игрок не скрывает, что РПЛ для него лишь переходный этап перед топ-чемпионатом.

Разговоров велось много, но на деле Хвича по-прежнему в команде, а о переезде в другой чемпионат говорится все меньше и меньше. Новости о заинтересованности в грузине появляются, но до деталей дело так и не доходит.

Из последнего, что появлялось в СМИ: менхенгладбахская «Боруссия» готова заплатить 18 миллионов евро за Кварацхелию. Также «Лидс» продолжает проявлять заинтересованность в грузинском полузащитнике. Олег Яровинский в том же интервью СЭ заявил, что ожидать перехода Кварацхелии в ближайшее время вряд ли стоит:

«Во-первых, клуб должен принять такое решение. Во-вторых, клубов, которые его могут подписать, гораздо меньше, чем кажется широкой общественности. Уже много раз говорил, что ситуация с Хвичей очень сильно взбудоражена общественностью. Все ждут, что же будет. Это очень большой и дорогой трансфер. Такие переходы занимают больше времени, чем людям кажется. Есть много сопутствующих факторов»

Наблюдается тенденция, что уровень команд, желающих приобрести Хвичу, снижается. Начиналось все с разговоров о «Боруссии» из Дортмунда и о «Ювентусе».

Понятно, что топ-клубы ведут десятки игроков для потенциального трансфера и Хвича входит в шорт-листы ведущих европейских клубов. Но игровое время Кварацхелии там обещать не могут, а в клубах ниже рангом он сможет заиграть на постоянной основе, главное, что ценник за Хвичу не падает и колеблется на уровне 18—20 миллионов евро. И если этот переход состоится, то в финансовом плане «Рубин» сможет покрыть все свои предыдущие затраты, еще и прикупить игрока на замену грузину.

Но и здесь мы возвращаемся к вопросу, а как это скажется на командном прогрессе?

Новичок казанцев Сеяд Хакшабанович уже вовсю вливается в состав команды. Фото rubin-kazan.ru

Тренерскому штабу вряд ли придется ломать голову над тем, как заменить ушедших лидеров

«Нам хватает игроков, у нас серьезная конкуренция внутри команды» — еще одна цитата Олега Яровинского, которая говорит о том, что активную трансферную кампанию клуб вести не будет.

Судя по всему, переход Монтассара Тальби стал финальным штрихом в комплектовании команды. Сейчас у «Рубина» сильная конкуренция внутри команды: новичок казанцев Сеяд Хакшабанович уже вовсю вливается в состав команды, а ушедшего Старфельта пока неплохо заменяет Сильвие Бегич. А вот Солтмурад Бакаев и Зуев пока не выглядят той заменой, которая достойно может восполнить Макарова.

Результат на короткой дистанции пока не страдает. Но сможет ли «Рубин» продолжать набирать очки на внутренней арене и держать уровень, совмещая с играми в Европе? Пока казанцы уверенно идут в РПЛ, продолжают борьбу в Лиге конференций и явно рассчитывают на успешное выступление на всех фронтах в этом сезоне.

Сегодня мы видим, что в Казани выстраивается хорошая команда, которая дает результат на поле и при этом справляется с реалиями современной бизнес-стратегии в футболе. Как долго может работать и давать плоды такая стратегия на два фронта (бизнес и качественный футбол)? Покажет сезон.

Игорь Белоногов

СпортФутболЭкономикаФинансыБюджетИнвестицииОбщество Татарстан

Самый молодой вице-президент в истории российского футбола.

Максим Мотин ‒ о ФК “Москва”, Мегафоне, ОИ-2014, переезде в Украину и секс-стартапе

Self-made — путь, который вдохновляет героя сегодняшнего интервью. Когда-то он его проделал сам: ещё тинейджером Максим Мотин развивал “ФК Москва” в роли пресс-атташе, затем стал руководителем пресс-службы, после — вице-президентом клуба. 

Некогда славный проект в силу известных нефутбольных причин прекратил существование в 2008 году, после чего в жизни нашего героя был пост главы академии ФК “Локомотив”, эпопея с работой в топ-менеджменте Мегафона и Олимпийскими играми 2014, переезд из России в Украину. 

По Zoom-мосту “Санкт-Петербург — Киев” управляющий партнёр Sportsoft Иван Рындин пообщался с Максимом Мотиным и узнал, чем он занимается сегодня. 

Спойлер: строительством инфраструктуры спортивного бизнеса в Незалежной, преподаванием и стартапами из категории 18+.

***

— Приветствую, Максим, рад тебя видеть, ты первый гость из-за границы! Первый традиционный вопрос: вместе со всем твоим опытом в спорте, кем ты сам себя ощущаешь?

— Я человек, ищущий чего-то нового, которому интересно работать в проектах, которые приносят результат и лично мне интересны. Процесс ради процесса — это не ко мне. Причем интересует меня не только спорт, но и шоу-бизнес, стартапы. Вообще XXI век — это век стартапов, время IT. Причем абсолютно во всех сферах!

— Работая в спорте с 18 лет, ты умудрился довольно быстро стать вице-президентом клуба, в который пришел. Какие качества тебе в этом помогли?

— Вообще мало кто знает эту историю. Я тогда пришёл к своему начальнику, Виктору Николаевичу Горлову, президенту Детской футбольной лиги, чтобы увольняться. Я работал у него в ДФЛ и газете “Труд”. Это был 2003 год. Пришел я к нему потому что у меня на руках было предложение стать пресс-атташе мини-футбольного клуба “Динамо”. Как только он увидел меня в кабинете, воскликнул “О, Макс, заходи! У тебя сегодня вечером будет собеседование!”, а время уже 18 или 19 часов. А я ребёнок, мне 18 лет только стукнуло. И я ему сказал неуверенно, что хочу увольняться. Он спросил, куда я собрался. Я ответил. Слышу: “Макс, ну какой мини-футбол, когда тебя большой футбол ждёт! У тебя сегодня вечером собеседование в “Торпедо-Металлург” у Белоуса (Юрий Белоус — президент “Торпедо-ЗИЛ”, позже — “Торпедо-Металлург” и “ФК Москва” с 2002 по 2008 год — прим. ред.). Собирайся, Восточная улица, 107 офис, через два часа тебя ждут, вот телефон”.

Это была зима, февраль-месяц, я озябший приехал в этот офис, постучался. Вижу Белоуса. Благо мы чуть-чуть были знакомы. Он со мной пообщался и из его кабинета я уже вышел исполняющим обязанности пресс-атташе ФК “Торпедо-Металлург”. Меня отвели в соседнюю комнату, а там Виктор Михайлович Шустиков день рождения празднует. Юрий Викторович меня представил так, как он это умеет делать, — оратор от бога! — и познакомил меня со всеми. Шустиков мне вручает рюмку водки и говорит: “Ну, с началом работы!”.

— Плавный заход в спорт, однако!

— Вот так из увольняющегося человека я превратился в самого молодого пресс-атташе, наверное, в истории футбола на тот период. Я начал работать и не боялся экспериментировать. 

— Позволялось ли тебе это?

— Никогда никого не спрашивал! Еще ребёнком в школе, классе в 10-м, я брал микрофон, шёл в театр, и просто подходил к людям, задавал вопросы, дома переводил на бумагу мои “интервью”. Журналисты с детства для были кумирами, богами. 

Однажды наткнулся на двух девчонок, которые мне ответили, что сами журналисты. Они шли к режиссеру театра и я попросился к ним, соврал, что я журналист детской школьной газеты. Мы два часа брали интервью у режиссера Театра на Таганке. Как сейчас помню, там был спектакль про Высоцкого. После этого двухчасового интервью я честно признался девчонкам, что обманул их, что я не журналист. Они спросили: “А что, ты хочешь им стать? Ты ведь никогда не заработаешь этим денег!”. Дали номер телефона, чтобы я им позвонил в редакцию. 

Я позвонил, затем пришел в газету “Московские ведомости”, которая позже превратилась в газету “Жизнь”. Мне сказали, чтобы я писал о чем пожелаю. А так как я увлекался спортом, выбор был очевиден.

Писал, писал, писал — но ничего не выходило. Меня правили, в меня верили, помогали. Со временем я понял, что надо писать о том, о чем не пишет никто. Стал писать статью о необычных людях, музыкантах, ездил на интервью на байк-фесты разные. Было очень смешно, когда там выставка боди-арт, а 16-летний рёбенок пытается взять интервью у обнажённой девчонки. Мои статьи стали публиковать со временем. 

В газете “Труд” запустил свой “Что? Где? Когда?”. Я просто поклонник телепередачи. Придумал так, чтобы мы задавали вопросы, читатели отвечали, а мы дарили подарки за правильные ответы. Мы получали сотни писем от людей в итоге.

Недавно я набрался смелости и написал Максиму Поташёву. Поблагодарил его за то, что 20 лет назад он меня поддержал в этой инициативе, помогал с вопросами. И он меня вспомнил!

Я уверен: надо заниматься тем, что любишь. Если есть дело, которое ты любишь, его полюбят и такие же как ты, 100%! Совет мой один: делайте не то, что понравится другим, а то, что нравится вам! Вы — паттерн поведения.

— Слушая тебя, пытаюсь понять, благодаря каким качествам, у тебя так пошло с ранних лет. Вижу, как минимум любознательность и смелость.

— Повторюсь, никогда не боялся экспериментировать. В 19 лет, когда я работал в “Москве”, была история с генеральным информационным партнёром. Тогда у всех были партнёрства или с “Советским спортом”, или со “Спорт-Экспрессом”. Но я провел исследование и понял, что наша целевая аудитория (а это были дети с родителями и подростки) читают журнал “Молоток”. Это было такое “желтое” издание, которое даже хотели запретить. В итоге, я договорился, чтобы они стали нашими партнерами. Это стало выгодно всем. Мы получили эксклюзивный выход на нашу ЦА (информация о нас была в каждом номере), а они рекламу на бортах, когда матчи показывал “Первый канал”. Win-win. Но многие этого не понимали и считали меня сумасшедшим. 

— А как ты проделал путь до вице-президента?

— Сначала и.о. пресс-атташе, потом пресс-атташе, потом, по мере роста опыта и знаний, нужен был следующий шаг. У нас был проект “Русский “Челси”, в рамках которого мы 150 болельщиков отвезли на матч “Челси” — “Арсенал” в 2003 году, у нас был чартер. Тогда же я стал главным редактором журнала Russian Chelsea. Интересная история.

Мы поехали в Лондон, меня очаровал просто антураж Премьер-Лиги, стадион, даже программки на матч. Я подумал: “Хочу так же!” И мы начали делать мегакрутые программки. Мы стали делать журнал 96-полосовой первыми в росфутболе. Коллеги звонили, жаловались, что их боссы, увидев программки “Москвы”, заставляли делать такие же!

Понимаешь, когда становится много обязанностей, ты должен нанимать сотрудников, соответственно, из пресс-атташе я стал руководителем пресс-службы. Потом директором по развитию и позже вице-президентом. Но у нас был всегда небольшой коллектив, не было раздутого штата. Так что, не придаю этому особого значения. 

Мне в своё время, еще во времена моей работы в газете “Труд”, очень помог Сергей Королёв, руководитель пресс-службы ФК “Локомотив”. Он мне позволял практиковаться, от “Труда” я ездил на памятный матч с “Галатасараем” в Стамбул, летел обратно чартером вместе с командой. Я сидел рядом с Сергеем Овчинниковым. Очень приятные воспоминания! Мне тогда лет 17 было. 

Впоследствии, уже пообщавшись, мне было легче получать какие-то эксклюзивы из команды, появилось доверие, я примелькался, меня воспринимали как своего. 

— Как круто! Какие ощущения у тебя были? Это воспринималось как должное или ты понимал, что это отчасти авансы и больше было благодарности? Как все это было?

— Все воспринималось как шанс, который нужно хватать. Не смотреть вокруг, действовать и действовать. Нужно было продолжать эту сказку.

Все, что ты делаешь — это твой будущий бэкграунд. Не стоит ожидать сиюминутного результата, так не работает, особенно в спорте. Прежде чем добиться победы, ты должен много тренироваться. Лишнего опыта не бывает.

Мегафон, ОИ-2014, “Каннские львы”

— Для меня твоё имя стало известно несколько лет назад в связке с “Мегафоном”. Я думаю, многие люди из числа спортивных менеджеров, воспринимают тебя именно в этом контексте. Работа в крупной компании часто воспринимается как идеал, как то, к чему нужно стремиться. Какие плюсы и минусы в такой работе?

— Крупные компании — это колоссальный опыт, доступ к огромному пласту статистики, исследований. Понятно, что Мегафон — одна из самых крупных компаний, это огромные возможности по поиску топовых сотрудников на каждую из позиций. Каждый день ты имеешь возможность общаться с профессионалами абсолютно в разных областях. Я жалею, что знаний, которые я получил в Мегафоне, у меня не было в ФК “Москва”. Оглядываясь назад, я понимаю, что мы сделали очень многое, но еще больше мы не сделали. Сейчас бы я на процентов 80 поменял то, что я делал в “Москве”. И делал бы более научно, с привлечением большего числа маркетинговых инструментов.

Очевидные плюсы работы в крупной компании — это возможности. Минусы — тяжело делать проекты. Чем крупнее компания, тем сложнее принятие решений. 

Второй момент: сложность делать точечные проекты. Мегафон в этом плане начал развиваться раньше чем все остальные. Например, шикарный кейс был во время чемпионата мира 2018 с кокошниками. Очень оперативно сработали, просто супер! 

Чаще же всего в крупных компаниях происходит всё долго, много времени тратится на совещания, встречи, и очень мало возможностей просто сесть и покреативить. У меня были такие “депрессии”: 24/7 занят, весь в делах, еще на сотню писем нужно ответить, а по факту ты за полгода ничего не сделал. Ну, вот и думаешь: а зачем это всё? 

— А какая у тебя должность была?

— Я работал в пиаре. Сначала работал руководителем социальных и благотворительных программ, потом — руководителем бизнес-коммуникаций. 

— Как внутри такой большой компании ставятся задачи руководителю направления? Как внутри происходит осознание важности того или иного направления и как это превращается в KPI?

— Тут три направления. Бизнес-направление — это коммерческие проекты, которые влияют на имидж и бизнес. Второе направление — социальные и благотворительные программы. Третье — проекты, которые просто нужно проводить, скажем так.

Я пришел в компанию тогда, когда она уже была спонсором Универсиады, Олимпийских и Паралимпийских игр в Сочи. Я приходил, чтобы усилить спортивное направление. Мегафон, если посмотреть и вспомнить, что было в 2012-2013 году, не был лидером мобильной связи в России и многим не воспринимался так. Он был где-то даже третьим. Cтатистика в b2b была очень печальная.

— Рулил МТС в b2b?

— Да, МТС был недосягаем. Все крупные компании работали с МТС, не воспринимая Мегафон как корпоративную связь для себя. Когда Мегафон стал спонсором ОИ-2014, это позволило кардинально изменить отношение к компании. Та работа, которая была проделана, позволила показать важность бренда. Если Мегафон доверили Олимпийские игры, то свою компанию вы можете доверить 100%. 

— На каком уровне принимается это решение, что нужно перепозиционировать себя? Кто стоит за этим шагом?

— У Мегафона в этом плане был очень крутой специалист, Тигран Погосян, который вел олимпийский проект. Он жил этим. Мы понимали, что 2014 год будет поворотным, будет годом внедрения и демонстрации LTE, возможностей 4G. 

Самый распространенный негативный вопрос, который задавали относительно спонсорства: мол, вот вы кучу денег потратили на ненужную Олимпиаду. Ты должен находить, что ответить, чтобы не уронить имидж компании.

Тут очень помог опыт Олимпиады 2012 года. Там Bridge Telecom был спонсором и им задавали точно такие же вопросы. И они публиковали статистику просто: количество отложенных контрактов, количество денег, которые оператор заработал за счёт ОИ, отбили инвестиции за год-полтора. Нам это тоже помогло. Мы тоже демонстрировали на уровне цифр, что за счёт Олимпийских игр Мегафон очень сильно вырос в b2b. 

— Сколько денег потратил Мегафон на эту кампанию, или это секрет?

— Слушай, это не секрет, мне просто тяжело сейчас вспомнить цифры точные. Цифра она публична, её можно найти. Был контракт с Ростелекомом, контракт был поделен пополам, плюс там была часть, которая платилась деньгами, а часть — инфраструктурой. Нужно же было строить её, все эти базовые станции, для вещателей и т.д. Была задача: чтобы Мегафон стал видимым игроком на этих Олимпийских играх. Поэтому отдел маркетинга придумывал разные концепции, как сделать так, чтобы нас заметили. И так родилась история с Мегаfaces, которая принесла номинацию и победу на “Каннских львах” (“Каннские львы — фестиваль, который считается наиболее авторитетным в мировом рекламном бизнесе — прим.ред.). Мы с этого получили колоссальный пиар.

“Я верю в сделки, где для бизнеса есть прямой коммерческий эффект. Имиджевые сделки будут сходить на нет”

— Нас читают и слушают люди, которые не работают на уровне Мегафона или Олимпиады, а занимаются менеджментом в небольших спортивных организациях. Они хотят так или иначе привлечь спонсоров и партнёров. Как ты считаешь, есть ли у небольших компаний возможности сотрудничать с крупными?

— С очень крупной компанией у локальной компании напрямую сотрудничать шансов практически никаких. Но. У каждой крупной компании есть представительство в регионах, есть офисы. Вот с региональными офисами сотрудничать не составляет никаких проблем. 

— А можешь привести примеры?

— Дай подумать… Помню, клуб из КХЛ сотрудничал с нами. Мы были их главным оператором. Также мы немного поддерживали Академию Леонида Слуцкого в Волгограде. Дарили планшеты, другую поддержку оказывали. С КАМАЗом было партнерство, поддерживали старты биатлонистов. Это я сейчас пытаюсь вспомнить только региональные проекты. Федеральных спортивных проектов у Мегафона было больше, их все знают. 

— А в чем была мотивация делать это для Академии Слуцкого?

— Тут комплекс причин, как любит говорить Леонид Викторович (смеётся). Я знаю, в какой ситуации оказалась школа, и мне кажется, поучаствовать в этой истории просто через подарки, призы, которые стоят не так дорого, возможность интегрироваться с лучшим спортивным проектом города на тот момент — это выгодно для компании. Плюс хотелось помочь Леониду Викторовичу с его школой в той ситуации, в которой она оказалась. 

Еще в Нижегородской области заливали каток зелёного цвета, в цвета Мегафона. Кто-то может сказать, что бред, но об этом написали все, это привлекло внимание.

Несколько лет мы были спонсорами катка на Красной площади. Из года в год мы делали там мероприятие для журналистов, партнёров. Создавалась неформальная обстановка, идеальная для b2b. 

— Как узнать, что крупной компании интересно в плане спонсорства? Как выстроить диалог правильно?

— Прийти и спросить.

— Вот так?

— Да. Все эти люди — специалисты пиара и маркетинга — публичные, обращайтесь к ним и там вам точно скажут, что интересно.

Я точно знаю одно: если вы заинтересованы в налаживании спонсорских коммуникаций и отправите одну презентацию всем подряд, то 99,9%, что её не посмотрят и вам не ответят. Если вы действительно готовы работать с той или иной компанией, то потратьте пожалуйста время.  

Вы же хотите, чтобы человек открыл презентацию, прочитал её, потратил своё время? 

— Значит потратьте своё время!

— Вот именно. Зайдите на сайт компании, посмотрите её спонсорскую политику, ценность, которую она стремится донести до людей, что для неё важно, и составьте презентацию с учётом этих требований. Я сужу по своему опыту: я на общие презентации даже не реагировал, но готов был всегда встречаться и идти навстречу реально заинтересованному человеку. Уделять время, рассматривать идеи, приглашать целые отделы. Вот этот вариант мне гораздо ближе.

— Вот у нас есть платформа Join Sport, на ней работает больше 200 футбольных и хоккейных лиг, каждая со своей аудиторией, за год больше миллиона посетителей. Возможно ли партнёрство с крупным игроком у такой организации?

— На мой взгляд, да, конечно. Но нельзя действовать топорно: например, просто предложить перейти своим клиентам на Мегафон. У всех уже есть свои операторы, это им неинтересно.  

Но есть, например, если мы говорим об Украине, мобильный банк SportBank. У них фишка: 10% кэшбэка на все покупки, связанные со спортом. Если сделать так, чтобы пользователь, взаимодействующий в финансовом плане с вами, потратил 5 минут времени на установку приложения, выгоду приобретают все. При таком кейса ваш сегмент уже становится мегаинтересным для компании. Я верю в сделки, где для бизнеса есть прямой коммерческий эффект. Имиджевые сделки будут сходить на нет.

“Бюрократия — необходимое зло для крупной компании, но мне важна личная свобода”

Какой поворот был самым сложным в твоей карьере? Кстати, почему ты ушел из Мегафона?

— Это то, о чем я уже говорил: ты тратишь кучу времени, постоянно занят, но твоих проектов нет, в крупной компании их не может быть, это всегда проекты огромного количества людей. Даже если ты придёшь с интересной идеей — пока она пройдет всех юристов, финансистов, всех-всех-всех, она уже станет не твоей идеей. При этом она может даже стать лучше, я признаю, так как прошла через специалистов. Но она уже не твоя. В какой-то момент происходит эмоциональное выгорание, когда ты сам уже ничего не можешь придумать. Есть агентства, которые придумывают за тебя, делают за тебя, а ты превращаешься в человека, который ставит задачи и перекладывает бумажки. Это скучно. Я всегда лез в другие проекты.

Например, мы с другом Александром делали проект футбольной команды ШКИД. Это команда выпускников детских домов, там играли 63 пацана в общей сложности. Я договаривался с чемпионатом Москвы об их участии, они обыгрывали “Трудовые резервы”, которые тренировал сын Тарханова, ребят, которые занимались с детства в футбольной школе. Я вот тогда сидел на трибуне и кайфовал. При этом это был социальный проект, мы тратили свои деньги, нанимали людей, которые учили ребят писать резюме, проходить собеседования. Старались находить им работу и так далее. Это вот реально круто: видеть, как парень социализируется. Это то, что можно после себя оставить. 

У меня всегда было много проектов и идей, я никогда не был покладистым командным игроком. Я люблю риск, мне важен финальный результат. Бюрократия нужна, особенно для крупной компании, это необходимое “зло”, но мне нужна личная свобода. Я даже к психологу ходить в какой-то период времени начал. Ничего не радовало. Хотя у меня есть всё, казалось бы… Квартира в Москве, машина, деньги, я могу ходить в рестораны, путешествовать. Но приедается всё. В итоге я ушёл из компании. Прошла неделя и я почувствовал себя самым счастливым человеком. 

Украина, состояние спортивного бизнеса, кто №1 в индустрии

— Как в твоей жизни возникла Украина?

— Очень просто. Я наполовину украинец. Всегда любил Украину и всегда сюда приезжал. Знаешь, не хочется ударяться в политику…Я скажу так. Политика в России — знаю это, так как дважды был депутатом в Печатниках — она тяжёлая, когда ты идёшь не по общему пути. Я по другую сторону баррикад. Мне были закрыты многие дороги из-за моей политической позиции.

Однажды я просто понял, приехав в Киев, что не хочу возвращаться.

— Что ты увидел в украинском спортивном бизнесе, чем он отличается от российского?

— Он в гораздо худшем состоянии чем российский. Фактически в Украине нет ни одной программы подготовки для спортивных менеджеров. В Россию после 2014 года ездить учиться стало невозможно для них, европейские программы очень дорогие. До 14-го года был некий обмен опытом в рамках Единой лиги ВТБ, КХЛ, но это всё тоже прекратилось. С экономикой сложно, понятное дело. В итоге часть специалистов уехали в поисках лучшей жизни, часть сменили направление деятельности. 

Профессионалов спортивного бизнеса здесь осталось очень мало. Стало понятно, что это колоссальная ниша. Я с 2004 года преподавал в различных университетах, вёл спортивный менеджмент на журфаке МГУ. Еще тогда я написал программу, по которой и работал. Мы познакомились здесь, в Киеве, с ребятами, я стал программным директором Конференции спортивного бизнеса, которая должна была состояться в апреле в Киеве, но из-за карантина, к огромному сожалению, она перенеслась.

— В онлайне не стали проводить?

— Не стали. Но после этой конференции мы планировали запустить оффлайн-школу в Киеве. Так как всё это отменилось, я решил сделать курс спортивного менеджмента в онлайне. Уже больше двух месяцев эта история длится.

— Насколько было сложно набирать людей? Большой спрос?

— Мне все говорили, что это никому не нужны. Денег, мол, в индустрии нет, инфраструктура плохая… Все это я уже проходил в начале 2000-х, когда приходил студентом с горящими глазами. Я знаю, что такие люди есть, им просто нужно дать возможность. Сейчас на курсе учится 70 человек из 9 стран. Думаю, это отличный результат.  

— Конечно, очень даже.

— Учатся настолько разные люди, не поверишь. Игрок сборной Украины по баскетболу учится, футболисты из Премьер-Лиги России и Беларуси, хоккеисты, ребята из пятиборья, руководители спортивных объектов. Конечно, также учатся и те, кто нигде не работает, а только мечтает работать в спорте. Я уверен, что есть несколько человек уже сейчас, кто готов в будущем работать в спортивной индустрии. Я ни секунды не сомневаюсь. 

— А ты следишь за опытом российским? У нас же тоже трансформация в активной фазе.

— Конечно. Слежу, изучаю! Российский опыт, особенно если говорить о клубах из регионов, очень релевантен для постсоветского пространства. У меня много лекторов из бывшего СНГ и Восточной Европы. 

— Один из классических моих вопросов: за кем ты следишь из спортивных менеджеров? Кто тебе интересен? Из России или Украины.

— Могу назвать по три.

— Прекрасно!

— Run Ukraine и Виктория Веремеенко. Шикарный поток идеи с марафонами, забегами. Они продали на этот год все возможные слоты с точки зрения спонсоров. У них фантастические идеи. В этом году все медали должны быть в форме “Кобзаря” Тараса Шевченко. Они огромные молодцы.

Юрий Шаповалов. Шикарнейший кейс, который он делал с фехтовальщицей Ольгой Харлан. С неё сделали куклу Барби, которая продаётся по всему миру теперь.

Алексей Брага. Украинская хоккейная лига. Тяжело развивать хоккей в Украине, но он это делает, проводит огромную работу на морально-волевых, часто без денег, а по бартеру. Он молодец. В футболе работать гораздо проще, поэтому я даже не беру в расчёт. 

— Теперь Россия.

— Здесь у меня есть предвзятость, потому что я со многими работал лично.

Так как вопрос о тех, за кем я слежу, а не кого считаю лучшими, отвечу так: например, очень слежу за успехами Елены Малаховой. Уверен, что ты не знаешь её, но я помню эту девочку, которая пришла в пресс-службу ФК “Москва” со словами “Я хочу работать”. Как это было и у меня. 

У меня тогда для всех было одно и то же задание. “Вот дублёры — иди с ними делай интервью, отчёты, всё то, до чего у нас не доходят руки”, — говорил я. Она начала работать и очень здорово себя зарекомендовала, мы её взяли в штат. Потом, когда футбольный клуб “Москва” закрылся, я позвонил ей, Сергею Аксёнову в ЦСКА, порекомендовал Лену как классного специалиста. И она начала там работать. Много лет проработала там в отделе маркетинга и сейчас перешла на работу в киберспорт. Человек сделал карьеру. Это пример, когда человек пришёл с улицы, чего-то хочет и добивается. Многим мы давали возможность и они себя не реализовывали.

Второй человек, за кем я слежу — Марина Клычева. Она в 2003 году пришла к нам работать на ресепшн, отвечать на звонки. Она начала трудиться, вскоре перешла на работу в спортивный отдел футбольного клуба. Сейчас она работает в баскетбольной лиге ВТБ, занимается логистикой судей и так далее. Умничка! 

Слежу за Сашей Савраевой, прекрасное интервью у тебя было с ней. 

На самом деле, много людей. Александр Толстиков, президент португальской “Лейрии”, сто лет дружим с ним. Олег Яровинский, Антон Евменов, Леонид Слуцкий, Ирина Баранова… Мне тяжело, повторюсь, так как много людей, с кем я работал и кого знаю с самой положительной стороны. Боюсь кого-то выделить и кого-то не назвать. 

— А кто самый сильный менеджер в спортивной индустрии?

— Думаю, что это Дмитрий Сергеев. Он двигает индустрию, это мегатоп. Одно время мы с ним ругались, были в неважных отношениях, так как когда я работал в “Москве”, мы пытались забрать себе “Торпедо”, а он как раз занимался развитием еще одного “Торпедо-ЗИЛа”. Сейчас уже с юмором это всё вспоминается.

Дима — это топ-специалист. Думаю, что после проекта в СНГ он перейдет работать в Европу или США. 

— Согласен. Надеюсь, Дима нас услышит. Последний вопрос: как ты считаешь, какое вообще будущее у спорта в России, в Украине, вообще в мире?

— Я думаю, что спорт еще больше инкорпорируется в нишу развлечений. 

IT-технологии побеждают, поколение Z мало заинтересовано спортом в классическом виде. 

Спорт должен будет меняться, должны будут интегрироваться десятки, сотни стартапов, связанных с трансляциями, геймификацией, статистикой, с возможностью влиять на матч, результат. Я ожидаю, что стартапы захватят спорт. 

Сейчас я сам делаю стартап. Правда, он связан не со спортом, а с темой секса — InLovery. Это секс-квесты, которые помогают снять барьеры в обсуждении темы секса, разнообразить эту часть своей жизни, подсказать оптимальные секс-игрушки и так далее. В марте выиграл место в испанском акселераторе стартапов Demium и вот в рамках этой истории делаем с партнером стартап. Если что, скоро будем давать людям приложение на тест. Если есть желающие тестить — пишите (смеётся).  

— Интересно как!

— Вообще область стартапов — это крутейший новый мир, всегда думаю: “Где же я раньше был?!”. Но ничего, у меня еще все впереди. В том числе и в спортивной индустрии. 

Слушать на Soundcloud

Cлушать на Яндекс.Музыке

Слушать на PodFM

Cлушать на Apple Podcasts

***

Читать другие интервью спецпроекта #людиспорта:

Ярослав Мешалкин, директор по развитию EsForce

Елена Скаржинская, эксперт по киберспорту и интеллектуальным видам спорта

Александр Ким, глава отдела развития ФК «Сочи»

Александра Савраева, директор по развитию «СБК. Спорт Бизнес Консалтинг»

Андрей Дейнеко, спортивный менеджер и функционер

Иван Катанаев, директор по глобальному развитию Sportrecs

Александр Прудников, футбольный менеджер

Артём Милаков, глава Strategium, Спорт как бизнес

Илья Штеблов, спортивный директор ФШ «Юниор», MetaFootball

Что происходит с фшм какие планы на 2013. Футбол


Директор Академии «Динамо» Александр Кузнецов: «Наша задача – иметь конкурентоспособных игроков на каждой позиции в каждом возрасте

«Мы три-четыре года назад придумали «посвящение в динамовцы», церемонию на которой старшие ребята повязывают шарфы клуба на манер пионерских галстуков на шеи юным футболистам. Запоминающееся событие для детей и родителей. А уж у футболистов постарше, которые пришли к нам в юном возрасте, прикипели к клубу, приняли традиции «Динамо», требования и теперь попали в молодежную команду, из них «Динамо» каленым железом не вытравишь.»


2014-02-14 06:55:44

Ефрем Вартанян: «Только упорно работая, можно чего-то добиться»

После победы в 2-м «Зимнем Кубке» «Футбольный Петербург» пообщался с один из героев турнира, нападающим «Зенита» U-15 Ефремом Вартаняном о самой трудной игре, кумире, принципиальном сопернике, технике, «звездной болезни», главной мечте и многом другом. — Ефрем, поздравляем с победой в II «Зимнем Кубке»! Первый вопрос очень простой. Нет источника, где написано, сколько ты забил мячей точно в этом турнире и стал ли лучшим бомбардиром. Проясни ситуацию?


2014-02-11 06:18:26

Иван Шабаров: «В нашей команде потенциал нападающих и защитников примерно одинаков»

Перед стартом во 2-ом «Зимнем Кубке» (1-2 февраля) главный тренер команды Академии «Зенита» U-15 Иван Шабаров дал интервью «Футбольному Петербургу». — Прошлый сезон сложился удачно для вашей команды: чемпионство на городе, серебро на России, победа сборной Северо-Запада. Что ждете от нового сезона?


2014-02-03 07:43:30

ФШМ в моем сердце . Интервью с Евгением Юрьевичем Милешкиным.

Все мое становление как футболиста проходило в родной ФШМ (1967-77 годы), а вот первый профессиональный контракт я подписал с Локомотивом в 1978 году(чтобы не путать со школой Локомотив). Огромную роль в моем воспитании как человека , так и в понимании футбола, в детстве сыграли такие тренеры, как Цирик Б. Я. и Ивакин В.Г., а в профессиональной карьере — Бесков К.И. и Семин Ю.П.


2014-02-03 05:18:11

Кузьмичев стал кандидатом на пост спортивного директора ЦСКА

Kuzmishov.png После ухода Антона Евменова с поста спортивного директора «армейцев» на освободившуюся должность претендуют два основных кандидата: представитель агентсва SPORT INVEST в России Олег Яровинский и директор клубной академии московского «Локомотива» Владимир Кузьмичев. Президент «армейцев» Евгений Гинер после нескольких спорных трансферов ЦСКА принял решение уделить особое внимание системе подготовки воспитанников клуба и поиску молодых талантов в России. По информации, полученной от одного из сотрудников ЦСКА, переговоры с Яровинским и Кузьмичевым состоятся уже на этой неделе. Источник http://www.sovsport.ru/blogs/blog/bmessage-item/22481


2014-01-28 05:16:51

Леонид Вороховский: «У нас в городе, кроме «Зенита», футбола практически нет ни на детском, ни на взрослом уровне»

Главный тренер «Василеостровца» Леонид Вороховский после победы в Зимнем первенстве Санкт-Петербурга над «Звездой-д» поделился мыслями об игре, пользе данного турнира, об отсутствии его игроков в составе сборной Санкт-Петербурга на Кубке Содружества и словах Вячеслава Мельникова о проблемах детско-юношеского футбола. Вороховский.png


2014-01-27 07:32:05

Правила хорошего «Эвертона». Как академия «синих» подготовила основе 34 игрока за 7 лет

Тем постоянным читателям, кому нижеследующий текст покажется очередной вариацией на темы многих других, написанных об Академиях «Реала», «Барселоны», «Порту», «Бенфики», «Спортинга», «Бока Хуниорс» и прочих передовиков мирового футбольного образования, я приношу свои глубокие и искренние извинения. Вы правы, мои наблюдательные друзья, все это уже было.


2014-01-27 07:21:10

Руководитель Академии «Зенита» Хенк ван Стее: «Я хоть и не из Питера, но приложу все усилия»

Что позволило семнадцати­летнему Джамалдину Ходжаниязову заставить Спаллетти обратить на себя внимание? Кто из воспитанников Академии в ближайшее время сможет повторить его путь? Об этом и многом другом рассказал глава зенитовской Академии корреспонденту «Спорта День за Днем».


2014-01-24 07:27:59

Детским тренерам — особая лицензия

О специфике подготовки специалистов для детско-юношеского футбола размышляет заместитель технического директора Российского футбольного союза, руководитель департамента инновационной политики, науки и образования Андрей Власов.


2014-01-22 06:48:49

Почему юношеский футбол в Санкт-Петербурге обречен?

Все мы помним, как когда-то в «Зените» заблистали Аршавин, Кержаков и остальные. После восхождения этих ребят, с каждым годом воспитанников становилось все меньше, а их качество — все хуже.


2014-01-09 07:26:27

Турнир Гранаткина.

Международный юношеский турнир по футболу первого вице-президента ФИФА Валентина Гранаткина. http://granatkin.com/index.php/ru/


2014-01-03 09:06:03

Биография Ильи Цымбаларя

Экс-полузащитник московского «Спартака» и сборной России Илья Цымбаларь скончался в Одессе, где жил в последнее время.


2013-12-30 06:57:41

В такой футбол, как «Барселона», может играть только она

В такой футбол, как «Барселона», может играть только она, но все зачем-то пробуют медленно контролировать мяч и ничего, кроме контратак, не получают.


2013-12-29 12:18:39

26 декабря 00:29 Владимир Якунин: «Если нас освободят от «спортивной» нагрузки, мы будем только рады, но кто тогда будет все содержать?»

Президент РЖД Владимир Якунин прокомментировал инициативу членов Совета Федерации о запрете финансирования спортивных клубов государственными компаниями.


2013-12-26 06:48:37

Владимир Кузьмичев: «Конкурентоспособных игроков на двенадцать команд не хватает»

13 декабря футбольный клуб «Локомотив» стал обладателем специального приза РФПЛ за развитие детского футбола. Еще не зная об этой награде, мы поговорили с директором НОУ ЦСО «Локомотив» и «Локомотив-2» Владимиром Кузьмичевым о прошедшем сезоне и планах академии «железнодорожников» на будущее.


2013-12-20 06:51:21

Владимир Якунин: «Нельзя просто так прийти и сказать: «Давайте мы запретим госкомпаниям финансировать клубы»


2013-12-20 05:01:36

13 декабря 22:28 «Динамо» получило премию за развитие клубного телевидения, «Локомотив» – за развитие детского футбола

На состоявшемся 13 декабря торжественном вечере РФПЛ, посвященному окончанию футбольного года, получили свои премии «Премьер» «Локомотив» и «Динамо».


2013-12-16 05:48:49

Сергей Галицкий: «Государство должно поддерживать другие области, но если что-то быстро менять – можно потерять лигу»

Владелец «Краснодара» Сергей Галицкий рассказал о своем подходе к развитию клуба и поделился мнением о финансовом фэйр-плей. «Никакой пример никому я не показываю, потому что мы ничего еще не добились. Мы команда, которая развивается эволюционно. Нашим лучшим результатом пока было только, по-моему, девятое место. Что мы этим показали?


2013-12-16 05:37:13

Илларион Солодов: ««Футбольный Цех» создан для того, чтобы команды оттачивали свое футбольное мастерство»

Всем известно, как тяжело в нашем климате, и особенно в Петербурге, просто пойти и поиграть футбол на улице: то дождь, то снег, то штормовое предупреждение.


2013-12-13 05:15:09

10 декабря 23:48 Сергей Галицкий: «Мне интересен футбол, а не алюминиевый кубок, который я могу носить по квартире»

Владелец «Краснодара» Сергей Галицкий рассказал о своем отношении к футболу.


2013-12-11 05:25:13

«В «Локо» не сказали «нет», в «Зените» мнения разделились». Представитель Исламхана — о клубах РПЛ и переходе в «Аль-Айн»

Капитан сборной Казахстана Бауыржан Исламхан определился со своим будущим и теперь будет выступать за «Аль-Айн» из чемпионата ОАЭ. В эксклюзивном интервью Vesti.kz Марат Арчегов, представляющий интересы полузащитника, подробно рассказал, что помешало трансферу Бауыржана в «Локомотив», «Рубин» и «Зенит», как влиял на ситуацию Кайрат Боранбаев и была ли вероятность возвращения в «Кайрат»

— Марат, расскажите как началось ваше сотрудничество с Бауыржаном и как стартовала работа по поиску нового клуба для него?

— Наше сотрудничество началось относительно недавно, но при этом за Баториком я следил достаточно давно, видел, что это сильный футболист, который, на мой взгляд, перерос уровень казахстанской лиги и способен играть на более высоком уровне.

Прежде чем контактировать с игроком, я поинтересовался планами о его дальнейшем будущем у Кайрата Советаевича Боранбаева. У него была договоренность с рядом футболистов, что клуб отпустит их в качестве свободных агентов, в том числе с Баториком. Затем я спросил, не возражает ли Кайрат Советаевич, если я попробую устроить Исламхана в РПЛ, в частности в «Локомотив». Это был первый клуб, который возник у меня в голове, поскольку у них имеется дефицит на этой позиции. Кайрат Советаевич ответил, что стоит поговорить с Баториком, если он не против, то можно начать работу. Мы встретились с Баториком в Нур-Султане, все обговорили, он озвучил свои пожелания, я эти пожелания учел.

Началась работа. Первый клуб, с которым я общался, — «Локомотив». Они сказали, что знают игрока, давно за ним следили и он им потенциально интересен. Мы предварительно обсудили финансовый вопрос, те цифры, которые «Локо» готов был дать, оказались в пределах ожиданий Баторика. Но тут повлияли финансовый Fair Play и определенные сложности внутри клуба. Как мы видим, в настоящий момент «Локо» старается разгрузить зарплатную ведомость и пока осуществляет только трансферы на выход: были слухи про уход Хеведеса, уже ушел Смолов. То есть со стороны «Локомотива» не было ответа «нет» по отношению к Исламхану. 

После «Локомотива» действительно был интерес со стороны менее именитых российских клубов — «Урал», «Крылья Советов», но все-таки фокус был на большом клубе, который ставит перед собой высокие задачи.

Также проявлял интерес «Рубин». По моей информации, лично Леонид Викторович Слуцкий, его помощники и спортивный директор клуба Олег Яровинский очень внимательно анализировали Исламхана, просматривали матчи, но в итоге сделали выбор в пользу другого футболиста. У Слуцкого есть свои требования к позиции «десятки»: тот же Алан Дзагоев при нем глубоко опускался в оборонительную зону — Леонид Викторович хочет, чтобы у игрока этого амплуа были высокие показатели по отборам. Поэтому они сделали ставку на хорватского полузащитника (26-летнего Дарко Евтича, капитана польского «Леха» — прим. Vesti.kz).    

— Как возник вариант с «Зенитом»?

— Достаточно неожиданно. Поскольку Баторик играл вместе с Анатолием Тимощуком, именно он предложил Семаку пригласить Исламхана на просмотр. Сергей Богданович предварительно отсмотрел несколько игр Баторика, понял, каким техническим арсеналом обладает игрок, и дал согласие на его приглашение на сбор. Как объяснил Сергей Богданович, задача его тренерского штаба была посмотреть Исламхана на других скоростях.

Также в этой истории важно подчеркнуть большое уважение к Баторику, поскольку он решился поехать на просмотр. Он не побоялся выйти из зоны комфорта и принял этот вызов. Я общался со многими футболистами, большинство из них не рискнули бы ехать на просмотр, потому что это во многом лотерея.

Я специально  ездил в Катар и хочу прояснить ситуацию относительно просмотра Баторика в «Зените». Мы разговаривали  с Сергеем Богдановичем, он был очень доволен самоотдачей игрока на тренировках, тем, какой он объем работы выполняет, также отмечал качественную работу с мячом. Самому Баторику очень понравилось в «Зените», а именно атмосфера внутри команды, ребята очень хорошо его приняли. Да и со стороны было видно, что Сергей Богданович создает прекрасную обстановку в команде. Баторику было очень комфортно работать под руководством Семака.

Но возвращаясь к словам о лотерее. После матча с «Зальцбургом», на мой взгляд, внутри клуба мнения о будущем Бато в «Зените» разделились. При этом я разговаривал с Семаком до этого матча, он сказал, что в целом готов рассматривать его в качестве игрока «Зенита». Но, естественно, решение принимается коллегиально.

Негативный фон также создали эксперты, которые катком проехались по Исламхану. Но если объективно взглянуть на матч с «Зальцбургом», то он в целом получился неудачным для «Зенита». «Зальцбург» на самом пике, находится в отличном игровом тонусе и идет на первом месте в австрийской Бундеслиге, в то время как «Зенит» только проводит свой первый сбор. Скорости были совершенно разные.

Если брать конкретно Исламхана, то последний свой профессиональный матч он сыграл 10 ноября, то есть фактически два с половиной месяца назад. После этого был отпуск, далее он провел полноценный сбор с «Кайратом» и затем сразу присоединился к «Зениту» в Катаре. Контрольный матч с «Аль-Увайнахом» нельзя было серьезно рассматривать, то есть игра с «Зальцбургом», по большому счету, была первой для него на серьезном уровне после такого перерыва.

Еще добавлю, что обсуждалась возможность поехать на второй сбор с «Зенитом»,  доказать всем скептикам и руководству, что он заслуживает играть в этом клубе. Но, учитывая непростую ситуацию в клубе, связанную с Александром Кокориным, мы решили не ставить Семака в неудобное положение.

—  Правда ли, что Кайрат Советаевич все-таки повлиял на то, что Исламхан поехал на просмотр именно в «Зенит»?

— Авторитет Кайрата Советаевича, безусловно, имел вес. Ни для кого не секрет, что у него прекрасные отношения со многими футбольными функционерами, поэтому с его стороны участие наверняка имело место. Думаю, он сделал пару важных звонков, после которых Баторика пригласили на просмотр.

— Учитывая, что варианты с РПЛ постепенно отпадали, была ли хоть малейшая вероятность, что Исламхан вернется на короткий срок в «Кайрат»?

—  Думаю, Кайрат Советаевич был готов видеть его, но мы такой вариант не рассматривали. Задача была сменить декорации, попробовать себя в другом чемпионате.

— Контракт с «Аль-Айном» заключен на пять месяцев. Существует ли опция продления? И есть ли план продолжить работу по поиску команды для Исламхана с акцентом на РПЛ и Европу?  

— Опции по продлению в контракте нет, но руководители клуба говорят, что через пять месяцев они хотели бы вернуться к данному вопросу и обсудить возможность подписания долгосрочного контракта. Выбор в пользу «Аль-Айна» был сделан по нескольким причинам.

По нашей информации, игрока очень хотел видеть главный тренер Педру Эммануэл, из всех кандидатов на эту позицию Баторик был в приоритете. Фигура тренера была важным фактором для нас, поскольку он выигрывал Лигу чемпионов в составе «Порту», был ассистентом у Андре Виллаш-Боаша, самостоятельно работал в Португалии и Испании.

Немаловажно было и то, что клуб выступает в Азиатской Лиге чемпионов. Игровой практики здесь будет много. Для сравнения, если бы он поехал в Россию, то сыграл бы порядка десяти матчей. В «Аль-Айне» за полсезона ему предстоит сыграть 16-17 матчей, часть из которых — против лучших команд Азии. Конечно, об Азиатской ЛЧ мало что известно, но уровень команд там достаточно высокий, это тоже возможность показать себя на международной арене.

После пяти месяцев мы можем вернуться к варианту с «Зенитом» или к другим российским клубам. Тем более к лету в РПЛ вступит в силу новый лимит, и Баторик не будет там легионером. Тут уже будет важно, как он отыграет период в «Аль-Айне» — сейчас задача влиться в коллектив и показать максимум.

— Если говорить о финансовой составляющей, предложение «Аль-Айна» в целом было выше, чем то, что потенциально могли предложить российские клубы?

— Финансы были важным, но не ключевым фактором при принятии решения. Мы могли бы продолжать переговоры, подбирать наиболее подходящий вариант, либо у нас был готовый вариант с «Аль-Айном». В Эмиратах в ближайшие дни закрывается трансферное окно, поэтому вместо того, чтобы игрок находился в подвешенном состоянии какое-то время, было принято решение присоединиться к «Аль-Айну», где он может начать работу и провести максимально продуктивно ближайшие пять месяцев. Финансы в «Аль-Айне» сопоставимы с теми, что готовы предложить клубы первой восьмерки РПЛ, но я бы не сказал что там экстраординарные цифры.

Понятно, что был переговорный процесс и стояла задача получить как можно больше, ведь такова работа агента — добиться наиболее выгодных условий для клиента. Плюс фактор страны. К примеру, когда игроки едут из Европы в Россию или Казахстан, они ожидают увеличения заработка относительно домашнего чемпионата. Для ОАЭ этот принцип тоже работает.

Отметим, что Исламхан уже провел первую тренировку в составе «Аль-Айна» и рассказал о своей мотивации в новом клубе. Своим мнением о казахстанце также поделился главный тренер команды Педру Эммануэл. Кроме того, стало известно, когда 26-летний полузащитник может дебютировать за «Аль-Айн». 

Финал против «Реала» и рекорд лиги. Что известно о новом клубе Исламхана

Все самое актуальное о спорте в вашем телефоне — подписывайтесь на наш Instagram!

Русские, советские и постсоветские симфонии: национальная дискография Майка Германа

АБДУЛАЕВ, ХАЙРУЛЛО (р. 1930)
АБЕЛЕВИЧ ЛЕВ (1912-1985)
АДИГЕЗАЛОВ ВАСИФ (1935-2006)
АДЛЕР ЕФИМ (1937 г.р.)
АДЖЕМЯН АЛЕКСАНДР (1925-1987)
АГАФОННИКОВ ВЛАДИСЛАВ (1936 г.р.)
АХИНЯН ГРИГОР (1926-1991)
АХМЕТОВ ФАСИЛЬ (1935-1998)
АЛАДОВ НИКОЛАЙ (1890-1972)
АЛЕКСАНДРОВ АНАТОЛ (1888-1982)
АЛИ-ЗАДЕ, АКШИН (Б.1937)
АЛТУНЯН РУБЕН (1939 г.р.)
АМИРОВ ФИКРЕТ (1923-1984)
АНДРИЯСОВ ИОСИФ (1933-2000)
АНТОНЮК ВАЛЕРИЙ (1979 г.р., УКРАИНА)
АРАПОВ БОРИС (1905-1992)
АРЕНСКИЙ АНТОН (1861-1906)
АРИСТАКЕСЯН ЭМИН (1936-1996)
АРТЕМОВ ВЯЧЕСЛАВ (1940 г.р.)
АРУТЮНЯН АЛЕКСАНДР (1920 г.р.)
АШРАФИ МУХТАР (1912–1975, УЗБЕКИСТАН)
АСТВАЦАТРЯН ЛЕВОН (1922-2002)
АВШАЛОМОВ ААРОН (1894-1965)
БАФОЕВ, МУСТАФО (Б.1946)
БАХОР ФИРУЗ (1942 г.р.)
БАКИХАНОВ ТОФИК (1930 г. р., АЗЕРБАЙДЖАН)
БАЛАКИРЕВ МИЛИЙ (1837-1910)
БАЛАНЧИВАДЗЕ АНДРЕЙ (1906-1992)
БАЛАСАНЯН СЕРГЕЙ (1902-1982)
БАЛЕЙ, ВИРКО (р.1938)
БАЛТИН АЛЕКСАНДР(1931 г.р.)
БАЯХУНОВ БЕКИР (1933 г.р.)
БИБИК ВАЛЕНТИН (1940-2003)
БЛЮМЕНФЕЛЬД, ФЕЛИКС (1863-1931)
БОГАТЫРЕВ АНАТОЛ (1913-2003)
БОГОСЛОВСКИЙ НИКИТА (1913-2004)
БОЙКО РОСТИСЛАВ (1931-2001)
БОРОДИН АЛЕКСАНДР (1833-1887)
БОРТКЕВИЧ (БОРТКЕВИЧ) СЕРГЕЙ (1877-1952)
БРУСИЛОВСКИЙ ЕВГЕНИЙ (1905-1981)
БУНИН, РЕВОЛЬ (1924-1976)
БУНИН ВЛАДИМИР (1908-1970)
БУЦКО, ЮРИЙ (Б.1938)
БУЕВСКИЙ БОРИС (1935 г.р.)
БЫЧКОВ АНАТОЛИЙ (1929-1998)
БЗВАНЕЛИ ГУРАМ (1934 г.р.)
КАТУАР, ДЖОРДЖИ (1861-1926)
ЧАЛАЕВ ШИРВАЛИ (1936 г.р.)
ЧЕРНЯВСКИЙ ВЛАДИМИР (1947 г.р.)
ДАДАШЕВ АЗЕР (1946 г. р.)
ДАНЬКЕВИЧ КОНСТАНТИН (1905-1984)
ДЕНИСОВ, ЭДИСОН (1929-1996)
ДМИТРИЕВ ГЕОРГИЙ (1942 г.р.)
ДОМИНХЕН, КЛЕМЕНТИ (1907-1993)
ДОМОРАЦКИЙ ВЛАДИМИР (1946-2000)
ДОРОХИН, ВЛАДИМИР (род.1948)
ДРУХ ИГОРЬ (1966 г.р.)
ДЖАНИБЕКОВ АЛТИНБЕК (1934 г.р.)
ДЖАПАРИДЗЕ НЕМЕЦ (1939 г.р.)
ЕФИМЦОВА ЛЮДМИЛЛА (1948 г.р.)
ЕГИАЗАРЯН ГРЕГОРИЙ (1908-1988)
ЭШПАЙ АНДРЕЙ (1925-2015)
ЕВЛАХОВ ОРЕСТ (1912-1973)
ФАЛИК ЮРИЙ (1936-2009)
ФЕЛ, ЭЛЬНАР (1961 г.р., АЗЕРБАЙДЖАН)
ФИЛИППЕНКО АРКАДИЙ (1912-1983)
ФЛЯРОВСКИЙ АЛЕКСАНДР (род.1931)
ФРИД, ГРИГОРИЙ (1915-2012)
ГАБЕЛИЙ ИРАКЛИЕВ (1945 г.р.)
ГАБИЧВАДЗЕ, РЕВАЗ (1913-1999)
ГАБУНИЯ НОДАР (1933-2000)
ГАДЖИБЕКОВ, СУЛТАН (1919-1974)
ГАДЖИЕВ ДЗЕВДЕТ (1917 г.р.)
ГАДЖИЕВ РАУФ (1922-1995)
ГАВРИЛИН ВАЛЕРИЙ (1939-1999)
ГАЗИЗОВ РОБЕРТ (р. 1939)
ГИЕНКО БОРИС (1917-2000)
ГЛАЗУНОВ АЛЕКСАНДР (1865-1936)
ГЛЕБОВ ЕВГЕНИЙ (1929-2000)
ГЛИР, РЕЙНХОЛЬД (1875-1956)
ГЛИНКА МИХАИЛ (1804-1857)
ГЛОНТИ, ФЕЛИКС (род.1927)
ГЕДИКЕ, АЛЕКСАНДР (1877-1957)
ГОЛЬДШТЕЙН МИХАИЛ («НИКОЛАЙ ОВСЯНИКО-КУЛИКОВСКИЙ») (1917-1989)
ГОЛОВИН АНДРЕЙ (1950 г.р.)
ГОЛУБЕВ ЕВГЕНИЙ (1910-1988)
ГОМОЛЯКА ВАДИМ (1914-1980)
ГРЕТЧАНИНОВ АЛЕКСАНДР (1864-1955)
ГУБАЙДУЛИНА СОФИЯ (1931 г.р.)
ГУБАРЕНКО ВИТАЛИЙ (1934-2000)
ГУРЕВИЧ ЛЕОНИД (1932 г.р.)
ХАЙЕВ АЛЕКСЕЙ (1914-1994)
ИХМУРАТОВ АЙРАТ (род.1973)
ИППОЛИТОВ-ИВАНОВ МИХАИЛ (1859-1935)
ИВАНОВ КОНСТАНТИН (1907-1984)
ЮОН, ПОЛ (1872-1940)
КАБАЛЕВСКИЙ ДМИТРИЙ (1904-1987)
КАЛАЧЕВСКИЙ МИХАИЛ (1851-1910)
КАЛАФАТИ ВАСИЛИЙ (1869-1942)
КАЛИННИКОВ ВАСИЛИЙ (1866-1901)
КАНЧЕЛИ Гия (р. 1935)
КАРАМАНОВ АЛЕМДАР (1934 г.р.)
КАРАЕВ ФАРАДЖ (1943 г.р.)
КАРАЕВ КАРА (1918-1982)
КАСПАРОВ ЮРИЙ (род.1955)
КЕНДЖАЕВ КАМИЛЬ (1939 г.р.)
ХАЧАТУРЯН АРАМ (1903-1978)
ХАЧАТУРЯН КАРЕН (1920-2011)
ХАГОРТЯН ЭДУАРД (1930-1983)
ХАХАНОВ ДУДАР (1921-1995)
ХАЛМАМЕДОВ НУРЫ (1940-1983)
ХАНОН (ХАНИН), ЮРИЙ (1965 г.р.)
ХОДОСЬКО ОЛЕГ (р.1964, БЕЛАРУСЬ)
ХОЛМИНОВ АЛЕКСАНДР (1925 г.р.)
ХРЕННИКОВ ТИХОН (1913-2007)
ХУДАНАЙЗАРОВ БАЙРАМДУРА (род.1946)
ХЫДЫРОВ ДАНАТАР (1953 г.р.)
КИКТА ВАЛЕРИЙ (1941 г.р.)
КЛЕБАНОВ ДМИТРИЙ (1907-1987)
КЛЮЧАРЕВ АЛЕКСАНДР (1906-1972)
КЛЮЗНЕР БОРИС (1909-1975)
КНИППЕР, ЛЕВ (1898-1974)
КОБЕКИН ВЛАДИМИР (1947 г.р.)
КОЧУРОВ ЮРИЙ (1907–1952)
КОЙШИБАЕВ МАКАЛИМ (1926–1986)
КОЛЕССА МИКОЛА (1903-2006)
КОЛУДУБ ЛЕВКО (1930 г. р.)
КОПЫЛОВ АЛЕКСАНДР (1854-1911)
КОРНДОРФ, НИКОЛАЙ (1947-2001)
КОТЛЯРЕВСКИЙ РОМАН ( 1917-1980)
КОЖЕВНИКОВ БОРИС (1906-1985)
КОЖЕВНИКОВА ЕКАТЕРИНА (род.1954)
КРАСОТОВ АЛЕКСАНДР (1936-2007)
КРЕЙН, АЛЕКСАНДР (1883-1951)
КУПРЕВИЧ ВИКТОР (1925-2005)
КУРБАНОВ ТУЛКУН (1936 г.р.)
КУЖАМЯРОВ КУДУСЬ (1918 г.р.)
КИВА ОЛЕГ (1947 г.р.)

ЛАТИФ-ЗАДЕ АЛИШЕР (1962 г.р.)
ЛАЗАРЕВ ЭДУАРД (1935-2010)
ЛЕВИТИН ЮРИЙ (1912-1993)
ЛЯПУНОВ СЕРГЕЙ (1859-1924)
ЛЯТОШИНСКИЙ БОРИС (1895-1968)
ЛОБАНОВ ВАСИЛИЙ (род.1947)
ЛОКШИН АЛЕКСАНДР (1920-1987)
ЛОМДАРИДЗЕ ЭЛИЗБАР (1945 г.р.)
ЛОПАТНИКОВ, НИКОЛАЙ (1903-1976)
ЛУППОВ АНАТОЛ (1929 г.р.)
ЛЮДКЕВИЧ СТАНИСЛАВ (1879-1979)
МАЧАВАРИАНИ, АЛЕКСЕЙ (1913-1995)
МАГДАЛИЦ ВЛАДИМИР (1951-2010)
МАЙБОРОДА ГЕОРГИЙ (1913-1992)
МАКАРОВА НИНА (1908-1977)
МАХМУДОВ МИРХАЛИЛ (1947 г. р.)
МАЛАХОВ АЛЬБЕРТ (1936-1969)
МАМЕДОВ, ЮНИС (род.1944)
МАРКЕЛОВ ПАВЕЛ (1973 г.р.)
МАРКЕВИЧ ИГОРЬ (1912-1983)
МЕЛИКОВ АРИФ (1933 г.р.)
МЕЕРОВИЧ МИХАИЛ (1920-1993)
МЯСКОВСКИЙ НИКОЛАЙ (1881-1950)
МИРИСЛИ РАМИЗ (1934-2015)
МИРШАКАР ЗАРРИНА (1947 г.р.)
МИРЗА-ЗАДЕ ХАЯМ (1935 г.р.)
МИРЗОЯН ЭДУАРД (1921-2012)
МНАЦАКАНЯН АЛЕКСАНДР (1936-2013)
МОСОЛОВ АЛЕКСАНДР (1900-1973)
МШВЕЛИДЗЕ ШАЛВА (1904-1984)
МУХАМЕДЖАНОВ СЫДЫХ (1924-1991)
МУХАТОВ, СЕРДАР (род.1945)
МУХАТОВ ВЕЛИ (1916-2005)
МУРАДЕЛИ, ВАНО (1908-1970)
МУРОВ АСКОЛЬД (1928-1996)
МУРТАЗИН РАУФ АХМЕТОВИЧ (1910-1994)
НАСИДЗЕ СУЛХАН (1927-1996)
НИКОЛАЕВ АЛЕКСЕЙ (1931-2003)
НОСЫРЕВ МИХАИЛ (1924-1981)
НУРЫМОВ ЧАРЫ (1941-1993)
НЯГА ГЕОРГИЙ (1922-2003)
ОГАНЕСЯН (ОГАНЕСЯН), ЭДГАР (1930-1998)
ОРБЕЛЯН КОНСТАНТИН (род. 1928)
ОВЧИННИКОВ ВЯЧЕСЛАВ (1936 г.р.)
ПАРСАДАНЯН БОРИС (1925-1997)
ПАВЛОВА АЛЛА (1952 г.р.)
ПЕЙКО, НИКОЛАЙ (1916-1995)
ПЕТРОВ АНДРЕЙ (1930-2006)
ПОДКОВЫРОВ ПЕТР (1910-1977)
ПОЛОВИНКИН ЛЕОНИД (1894-1949)
ПОЛОЗ НИКОЛАЙ (1936 г.р.)
ПОЛЯКОВ ВАЛЕРИЙ (1913-1970)
ПОПОВ ГАВРИИЛ (1904-1972)
ПРОКОФЬЕВ СЕРГЕЙ (1891-1953)
ПУЛОДИ, ШОДМОН (род.1943)
РАБИНОВИЧ-БАРАКОВСКИЙ АЛЕКСАНДР
(1945 г.р.)
РАХМАНИНОВ, СЕРГЕЙ (1873-1943)
РАХИМОВ ХАМИД (1927-1977)
РАКОВ НИКОЛАЙ (1908-1990)
РАУТИО, РОЙНЕ (1934-1960)
РАЙХЕЛЬСОН ИГОРЬ (р. 1961)
РАЗОРЕНОВ СЕРГЕЙ (1909-1991)
РЕВУЦКИЙ ЛЕВКО (1889-1977)
РИМСКИЙ-КОРСАКОВ НИКОЛАЙ (1844-1908)
РИВИЛИС, ПАВЕЛ (род.1936)
РОСЛАВЕЦ, НИКОЛАЙ (1881-1944)
РУБИНШТЕЙН АНТОН (1829-1894)
РУНЧАК ВЛАДИМИР (1960 г. р.)
РЯБОВ ВЛАДИМИР (1950 г.р.)
САИФИ, ДЖАЛИЛЬ (1932-2003)
САЛИЕВ АЗГАМ (1941 г.р.)
САЛМАНОВ ВАДИМ (1912-1978)
САЛЬНИКОВ ГЕОРГИЙ (1923 г.р.)
САПАЕВ ЭРИК (1932-1963)
САРЬЯН ЛАЗАРЬ (1920-1988)
ШНИТКЕ, АЛЬФРЕД (1934-1998)
ШВАРЦ, ИСААК (1923-2009)
СКРЯБИН АЛЕКСАНДР (1872-1915)
ШАЙМАРДАНОВА, ШАХИДА (род.1938)
ШАХИДИ ТОЛИБ (1946 г.р.)
ШАХИДИ ЗИЯДУЛЛО (1914-1985)
ШАМО ИГОРЬ (1925-1982)
ШАМСУТДИНОВА МАСГУДА (1955 г.р.)
ШАПОРИН ЮРИЙ (1887-1966)
ШАВЕРЗАШВИЛИ АЛЕКСАНДР (1919-2003)
ЩЕДРИН РОДИОН (1932 г.р.)
ЩЕРБАЧЕВ ВЛАДИМИР (1889-1952)
ЩЕТИНСКИЙ АЛЕКСАНДР (1960 г.р.)
ШЕБАЛИН ВИССАРИОНА (1902-1963)
ШИЛАКАДЗЕ, ШАВЛЕГ (род.1940)
ШОСТАКОВИЧ ДМИТРИЙ (1906-1975)
ШТОГАРЕНКО АНДРЕЙ (1902-1992)
СИЛАНТЬЕВ ЮРИЙ (1919-1983)
СИЛЬВЕСТРОВ ВАЛЕНТИН (р. 1937)
СИНИСАЛО, ХЕЛЬМЕР-РАЙНЕР (1920-1989)
СКОРИК МИРОСЛАВ (1938 г.р.)
СЛОНИМСКИЙ СЕРГЕЙ (1932-2020)
СМИРНОВ ДМИТРИЙ (1948 г.р.)
СМИРНОВА ТАТЬЯНА (1940 г.р.)
СМОЛЬСКИЙ ДМИТРИЙ (1937 г.р.)
СОКАЛЬСКИЙ ВЛАДМИР (1863-1919)
СОЛТАН ВЛАДИМИР (1953-1997)
СТАНЬКОВИЧ ЕВГЕНИЙ (ЕВГЕН СТАНКОВИЧ) (род.1942)
СТЕЙНБЕРГ, МАКСИМИЛИАН (1883-1946)
СТРАВИНСКИЙ ИГОРЬ (1882-1971)
СВЕТЛАНОВ ЕВГЕНИЙ (1926-2002)
СВИРИДОВ ГЕОРГИЙ (1915-1998)
ТАДЖИЕВ МИРСАДИК (1944-1996)
ТАГИЕВ АКМУРАД (1947 г.р.)
ТАКТАКИШВИЛИ ОТАР (1924-1989)
ТАНЕЕВ АЛЕКСАНДР (1850-1918)
ТАНЕЕВ СЕРГЕЙ (1856-1915)
ТАРАНОВ ГЛЕБ (1904-1989)
ЧАЙКОВСКИЙ АЛЕКСАНДР (род.1946)
ЧАЙКОВСКИЙ БОРИС (1925-1996)
ЧАЙКОВСКИЙ ПЕТР ИЛЬИЧ (1840-1893)
ЧЕРЕПНИН АЛЕКСАНДР (1899-1977)
ТЕР-ОСИПОВ ЮРИЙ (1933-1986)
ТЕР-ТАТЕВОСЯН. ДЖОН (1926-1988)
ТЕРТЕРЯН, АВЕТ (1929-1994)
ТИКОЦКИЙ ЕВГЕНИЙ (1893-1970)
ТИЩЕНКО БОРИС (1939-2010)
ТОПОРКОВ ДЖЕРАЛЬД (р. 1928)
ТОРАДЗЕ, ДАВИД (1922-1983)
ТРОЦЮК БОГДАН (1931-2009)
ЦИНЦАДЗЕ, СУЛКАН (1925-1991)
ЦИТОВИЧ ВЛАДИМИР (1931-2012)
УСТВОЛЬСКАЯ ГАЛИНА (1919-2006)
ВАГНЕР, ГЕНРИК (1922-2000)
ВАЙНБЕРГ, МОИСЕЙ (МЕЧИСЛАВ ВАЙНБЕРГ) (1919-1996)
ВАЙШТЕЙН ЛЕОНИД (1945-1994)
ВАСИЛЕНКО СЕРГЕЙ (1872-1956)
ВАВИЛОВ ГЕННАДИЙ (род.1932)
ВИЛЬДАНОВ РУМИЛЬ (1939-1987)
ВЛАСОВ ВЛАДИМИР (1902-1986)
ВОРОНЦОВ ЮРИЙ (1952 г.р.)
ЯНЧЕНКО ОЛЕГ (1939-2002)
ЯРОВИНСКИЙ БОРИС (1922-2000)
ЮРОВСКИЙ ВЛАДИМИР (1915-1972)
ЗАБОРОВ ГРИГОРИЙ (1929-1985)
ЗАКИРОВ НУРИЛЛА (1942-2003)
ЖИГАНОВ, НАСИБ (1911-1988)
ЖУБАНОВА ГАЗИЗА (1927-1993)
ЗОГРАБВАН АШОТ (р. 1945)
ЗОЛОТУХИН ВЛАДИМИР (1936-2010)
ЗУБИЦКИЙ ВЛАДИМИР (1953 г.р.)

Границы | NFAM1 способствует выработке провоспалительных цитокинов в моноцитах мыши и человека

Введение

NFAM1 представляет собой трансмембранный рецептор, который экспрессируется клетками врожденной и адаптивной иммунной системы. NFAM1 был обнаружен почти два десятилетия назад через скрининг in silico , предназначенный для поиска новых трансмембранных рецепторов, которые содержат как внеклеточный домен иммуноглобулина, так и цитоплазматический ITAM (1).Было показано, что NFAM1 активирует ядерный фактор активированных Т-клеток (NFAT), что приводит к экспрессии TNF-α, IL-13 и IL-2 (1, 2). Ингибиторы кальциневрина, такие как циклоспорин А и такролимус, блокируют активацию NFAT и уже давно используются для предотвращения отторжения трансплантата. Однако недавно было признано, что ингибиторы NFAT также могут ограничивать аутоиммунные заболевания [рассмотрено в Bendickova et al. (3)], так как NFAT играет важную роль в регуляции как врожденного, так и адаптивного иммунитета.К сожалению, ингибирование NFAT также сопряжено с риском повышенной восприимчивости к инфекциям. Таким образом, ингибирование специфических рецепторов, активирующих NFAT, таких как NFAM1, может ограничивать иммунную патологию, не вызывая широкой иммуносупрессии.

Повышенная экспрессия NFAM1 недавно наблюдалась при множественных иммунозависимых заболеваниях, что еще раз указывает на то, что ингибирование NFAM1 может иметь терапевтическое значение. Например, экспрессия NFAM1 повышается при костной болезни Педжета (PDB), заболевании, которое характеризуется чрезмерной резорбцией кости посредством аномальных остеокластов (4).PDB может быть вызван вирусной инфекцией, о чем свидетельствует обнаружение нуклеокапсидного белка вируса кори (MVNP) в педжетных остеокластах. In vitro , трансфекция клеток костного мозга мышей с помощью MVNP приводит к значительному увеличению экспрессии NFAM1, а кшРНК NFAM1 снижает индуцированную MVNP дифференцировку остеокластов и резорбцию кости, что позволяет предположить, что NFAM1 может играть роль в патогенезе PDB (4).

В качестве еще одного доказательства связи с заболеванием недавно сообщалось о повышении экспрессии NFAM1 в моноцитах периферической крови у пациентов с ишемической болезнью сердца (ИБС) (5).Анализ моноцитов CAD выявил сильную корреляцию между экспрессией NFAM1 и CCR2. Примечательно, что при ИБС известно, что CCR2 способствует рекрутированию патогенных моноцитов в воспаленный эндотелий, усугубляя образование бляшек и дестабилизацию. В экспериментах с потерей функции нокдаун NFAM1 в моноцитарных клеточных линиях коррелировал со снижением экспрессии CCR2 и соответствующим снижением трансэндотелиальной миграции, опосредованной MCP-1. Эти данные свидетельствуют о том, что NFAM1 может способствовать развитию мигрирующих патогенных моноцитов и может служить биомаркером ИБС (5).

При анализе данных транскрипции биоптатов ВЗК мы наблюдали повышенную экспрессию NFAM1. Поэтому мы стремились лучше понять функцию NFAM1, особенно в контексте ВЗК. Информация о функции NFAM1 in vivo в настоящее время ограничена исследованиями сверхэкспрессии, в которых перенос трансгенных клеток-предшественников костного мозга NFAM1 мышам дикого типа резко нарушал развитие периферических В-клеток (2). Однако, насколько нам известно, влияние удаления гена NFAM1 на модели целого животного еще не оценивалось.Поэтому мы создали мышей NFAM1 -/- и обнаружили, что, в отличие от результатов исследований сверхэкспрессии, делеция NFAM1 не нарушает развитие или созревание В-клеток. Тем не менее, делеция NFAM1 действительно влияет на функцию моноцитов, поскольку мы наблюдали, что по сравнению с моноцитами NFAM1 +/+ , моноциты NFAM1 -/- продуцируют меньше TNF-α при активации стимулами, связанными с ВЗК, такими как CD40L. Соответственно, мы наблюдали, что делеция NFAM1 в моноцитах человека также снижает опосредованную CD40L продукцию цитокинов, демонстрируя, что наши результаты не ограничиваются моноцитами мыши.Наконец, в мышиной модели ВЗК, индуцированной анти-CD40, у мышей NFAM1 -/- были снижены уровни сывороточного TNF-α, что еще раз подтверждает, что NFAM1 способствует воспалению.

Методы

Анализ экспрессии NFAM1 в наборах данных пациентов с ВЗК

Данные об экспрессии генов из биопсий кишечника, выделенных от здоровых людей и пациентов с ВЗК, были получены с веб-портала Gene Expression Omnibus (GEO). Набор данных GSE62207 включал следующие образцы: болезнь Крона толстой кишки ( n  = 51), болезнь Крона подвздошной кишки ( n = 208) и контроли без ВЗК ( n = 51) (6).Набор данных GSE117993 включал следующие образцы: болезнь Крона толстой кишки ( n = 32), болезнь Крона подвздошной кишки ( n = 60), контрольная группа без ВЗК ( n = 55) и ЯК ( n = 43) ( 7). Анализ был сделан с помощью ANOVA.

Выделение моноцитов человека для экспериментов с CRISPR-RNP

Моноциты человека для экспериментов с CRISPR-RNP выделяли из периферической крови человека, полученной из банка крови Сан-Диего. Протоколы сбора и обработки были одобрены Наблюдательным советом учреждения для образцов человека.Используя стандартизированный метод центрифугирования в градиенте плотности Ficoll-Hypaque (GE Healthcare), мононуклеарные клетки периферической крови человека (РВМС) отделяли от цельной крови, а CD14-положительные моноциты выделяли с помощью CD14-связывающих шариков Miltenyi Biotech (в соответствии с протоколами производителя).

Выделение субпопуляций иммунных клеток человека для определения экспрессии NFAM1

Т-клетки, В-клетки, NK-клетки и моноциты для экспериментов по экспрессии NFAM1 выделяли из периферической крови человека, полученной в рамках программы донорства крови Boehringer Ingelheim.Используя стандартизированный метод центрифугирования в градиенте плотности Ficoll-Hypaque (GE Healthcare), РВМС выделяли из цельной крови. Затем РВМС замораживали при -80°С до дальнейшего использования. Т-клетки, В-клетки, NK-клетки и моноциты выделяли из размороженных РВМС с помощью с использованием наборов для обогащения Stemcell Technologies (№19051, №19054, №19055 и №19058 соответственно). Нейтрофилы выделяли непосредственно из цельной крови человека с помощью с использованием набора для обогащения нейтрофилов Stemcell Technologies (#19257, метод лизиса эритроцитов).

Выделение субпопуляций иммунных клеток мыши

Моноциты и нейтрофилы выделяли из костного мозга; Т-клетки, В-клетки и NK-клетки выделяли из спленоцитов в соответствии со следующими протоколами: бедра и голени задних конечностей промывали средой для выделения клеток, состоящей из PBS (Gibco) с добавлением 2% инактивированной нагреванием эмбриональной телячьей сыворотки и 1% пенициллина/ стрептомицин (оба от Life Technologies). Пробки костного мозга диспергировали повторным пропусканием через иглу 27-го калибра (BD) и фильтровали через сито с размером ячеек 40 мкм (Falcon).Моноциты и нейтрофилы выделяли с помощью с использованием наборов для обогащения Stemcell Technologies (№19861 и №19762 соответственно). Селезенки разрывали тупым концом шприца и фильтровали через сито с размером ячеек 40 мкм (Falcon). Т-клетки CD4, Т-клетки CD8, В-клетки и NK-клетки были выделены с помощью с использованием наборов для обогащения Stemcell Technologies (№18952, №19753, №19854, №19755 соответственно).

Выделение РНК

РНК была выделена с помощью с использованием набора RNeasy Plus Mini (Qiagen).

RT-qPCR

РНК превращали в кДНК с использованием премикса EcoDry (Clonetech) в соответствии со следующим протоколом: 42 градуса Цельсия в течение 60 минут, 70 градусов Цельсия в течение десяти минут и 4 градуса Цельсия в течение 10 минут. RT-qPCR проводили с использованием универсальной смеси Taqman для ПЦР (Thermo Fisher) и следующих зондов Taqman: GAPDH человека (Hs 02758991-g), ACT-бета человека (Hs 99999903-m1), HPRT1 человека (4332657), NFMA1 человека (Hs00377608). -m1), NFAM1 человека (Hs 01066293-s1), GAPDH мыши (Mm99999915-g1), HPRT1 мыши (Mm03024075-m1) и NFAM1 мыши (Mm04336546-m1) (все от Thermo Fisher).

Проточная цитометрия

Спленоциты или стимулированные моноциты переносили на 96-луночный полипропиленовый планшет (Corning). Клетки инкубировали с красителем LIVE/DEAD Fixable Aqua Dead Cell Stain (Molecular Probes), разведенным до 0,1% в PBS, в течение 15 минут в темноте, дважды промывали PBS и блокировали в течение тридцати минут антимышиным антителом TruStain FcX (BioLegend), разведенным до 0,1% в буфере для окрашивания клеток (BioLegend). Для количественного определения моноцитов, дендритных клеток и NK-клеток спленоциты окрашивали смесью анти-CD4 клона RM4-5 в PerCP-Cy5.5, анти-CD8α клон 53-6.7 в PerCP-Cy5.5, анти-CD19 клон 1D3 в PerCP-Cy5.5, анти-Ly6G клон 1A8 в PE, анти-CD11c клон HL3 в PE-Cy7, анти-NK1. 1 клон PK136 в Alexa 700, анти-Ly6C клон AL-21 в APC-Cy7 и анти-CD11b клон M1/70 в eFlour 450. Для количественного определения субпопуляций CD4 и CD8 Т-клеток спленоциты окрашивали коктейлем анти- CD4-клон GK1. 5 в FITC, анти-CD25-клон PC61 в PE, анти-CD62L-клон MEL-14 в PE-Cy7 и анти-CD8-клон 53-6.7 в Pacific Blue. Для количественного определения В-клеток спленоциты окрашивали коктейлем анти-IgM клона RMM-1 в FITC, анти-B220 клона RA3-6B2 в PE и анти-IgD клона 1A6-2 в APC.Для характеристики моноцитов после стимуляции клетки окрашивали следующими антителами FITC: анти-CD80 клон 16-10A1, анти-CD86 клон GL-1, анти-MHC II клон M5/114.15.2, анти-MHC I клон AF6- 88.5 или анти-CD40-клон HM40-3 (BD). Все антитела были получены от BioLegend, если не указано иное. После окрашивания клетки дважды промывали буфером для окрашивания клеток, ресуспендировали в 200 мкл буфера FluoroFix (BioLegend) и анализировали на проточном цитометре LSRII (BD). Результаты были проанализированы с использованием программного обеспечения FlowJo.

Стимуляция моноцитов мыши

Моноциты мышей NFAM1 +/+ и NFAM1 -/- (изолированных, как описано выше) ресуспендировали в среде для культивирования клеток, состоящей из RPMI, 10% эмбриональной телячьей сыворотки и 1% пенициллина. Стрептомицин (все от Life Technologies). Моноциты культивировали в 96-луночном планшете для тканевых культур (Corning) в концентрации 20 000 клеток на лунку и либо не обрабатывали, либо предварительно обрабатывали в течение одного часа 100 мкг/мл мышиного IFN-γ (R&D Systems) и затем стимулировали ЛПС ( Sigma), MegaCD40L (Enzo), HKEB, HKLM, HKST, Pam3CSK4, Zymosan, FSL-1 или MDP (все от Invivogen).Через 24-48 часов после стимуляции собирали супернатант и собирали клетки путем промывки лунок холодным PBS. Клетки анализировали с помощью проточной цитометрии (подробности см. выше), а супернатанты анализировали с помощью MSD на наличие TNF-α (номер по каталогу K152BHB-4), IL-6, IL-12, MIP-1α и MIP-1β (MSD custom У-плекс).

RNAseq

NFAM1 +/+ и NFAM1 -/- моноциты не стимулировали, стимулировали 50 нг/мл только IFN-γ или IFN-γ плюс 1 мкг/мл MegaCD40L.Через 6 или 24 часа супернатант удаляли, клетки ресуспендировали в RNAlater (Qiagen) и выделяли РНК, как описано выше. Создание библиотеки и секвенирование выполняли в Пекинском институте геномики следующим образом: РНК фрагментировали и синтезировали кДНК с использованием протокола подготовки библиотеки мРНК Illumina Truseq polyA (нецепочечной). Секвенирование РНК выполняли на секвенаторе Illumina HiSeq2000 для получения прочтений парных концов 101×2. Данные RNAseq сначала были проверены с использованием fastQC, а затем сопоставлены с эталонным геномом мыши с использованием алгоритма STAR.Rsubread был применен для создания необработанных подсчетов с последующей нормализацией данных с помощью EdgeR. Дифференциально экспрессируемые гены (DEG) и биологический путь определяли с помощью LIMMA-Voom при кратности изменения >=2, adjPvalue<0,05 и clusterProfiler в BioConductor соответственно.

ДНК-конструкции NFAM1 человека

кДНК NFAM1, кДНК NFAM1 с N-концевой меткой FLAG, кДНК NFAM1 с C-концевой меткой FLAG, химерная конструкция, состоящая из внеклеточного и трансмембранного домена CD8α человека, слитого с цитоплазматическим доменом NFAM1 дикого типа или NFAM1, в которых тирозины ITAM были преобразованы в фенилаланины, все были клонированы в pcDNA3. 1 вектор. См. Дополнительные методы для последовательностей NFAM1.

Трансфекция 293 клеток NFAM1 с меткой FLAG

Клетки 293 (Invivogen) культивировали в минимальной основной среде Игла (ATCC) с 10% инактивированной нагреванием FBS (Gibco) и 1% пенициллином/стрептомицином (Gibco). Клетки трансфицировали кДНК NFAM1, несущей либо N-концевую, либо С-концевую метку Flag , посредством с использованием реагента для трансфекции TransIT-293 (Mirus), разведенного в среде Opti-MEM (Gibco). Через 48 часов после трансфекции клетки собирали, используя 0.05% тризин-ЭДТА (Invitrogen). Клетки окрашивали в течение 15 минут 0,1%-ным красителем Zombie NIR (BioLegend), разведенным в PBS, и дважды промывали. Для обнаружения экспрессии клеточной поверхности клетки немедленно окрашивали анти-FLAG-клоном L5 в PE (BioLegend), дважды промывали и ресуспендировали в фиксирующем буфере (BioLegend). Для выявления внутриклеточной экспрессии клетки инкубировали в стабилизирующем фиксаторе (BD) в течение 20 мин при комнатной температуре, дважды промывали и ресуспендировали в пермеабилизирующем буфере (BioLegend) перед окрашиванием анти-FLAG-клоном L5 в PE (BioLegend). Проточную цитометрию и анализ проводили, как описано выше.

Нуклеофекция клеток Jurkat химерными конструкциями CD8α/NFAM1

Клетки Jurkat-Lucia™ NFAT (InvivoGen) культивировали в среде RPMI 1640 с 10 мМ Hepes, 1 мМ пирувата натрия, 2 мМ L-глутамина, 50 мкг/мл Pen/ Шаг, 10% инактивированная нагреванием сыворотка эмбриона крупного рогатого скота (все от Life Technologies) плюс 100 мкг/мл нормоцина (Invivogen). Клеточная линия SE 4D-Nucleofector ® X Kit L (кат. № V4XC-1024 от Lonza) использовали в соответствии с протоколом производителя для нуклеофекции клеток Jurkat только вектором или слитыми конструкциями CD8α/NFAM1.Клетки выдерживали в течение 24 часов, промывали и переносили либо в чистый 96-луночный планшет, либо в планшет, покрытый 5 мкг/мл антитела против CD8α (Cat# BE0004-2, BioXCell). Через 24 часа супернатанты собирали и анализировали с использованием раствора для анализа QUANTI-Luc Gold (InvivoGen) в соответствии с протоколом производителя. Люминесценцию измеряли на считывателе микропланшетов TECAN со временем считывания 0,1 секунды.

Образование индуцированных тиогликолатом перитонеальных макрофагов

3% тиогликолят Брюера (BD) готовили в дистиллированной воде, автоклавировали и оставляли для созревания не менее чем за 2 недели до использования.Мышам внутрибрюшинно вводили 2 мл 3% тиогликолята в 0-й день. На 3-й день мышей умерщвляли и проводили перитонеальный лаваж с помощью иглы 18 размера и 10 мл PBS с 1% FBS, 1% гентамицина (все от Gibco) и 1 мМ ЭДТА (Sigma). Клетки дважды промывали PBS перед стимуляцией, как описано выше (см. протокол стимуляции моноцитов мыши).

Ответы на отзыв Т-клеток

OVA (Sigma), эмульгированный в полном адъюванте Фрейнда (Sigma), готовили следующим образом: OVA разбавляли физиологическим раствором до концентрации 6 мг/мл, а затем эмульгировали 1:1 в CFA для окончательного OVA. концентрация 3 мг/мл.Мышей анестезировали до операционной плоскости и вводили инъекции по 50 мкл с каждой стороны от основания хвоста до общего объема 100 мкл и общей дозы OVA 0,3 мг. Через десять дней после иммунизации животных умерщвляли и собирали паховые лимфатические узлы. Лимфатические узлы осторожно разрушали на клеточном сите с концентрацией 100 мкМ. Клетки дважды промывали PBS, а затем культивировали в RPM1 1640 с 10% FBS, 1x пенициллином-стрептомицином (Gibco) и 1x 2-меркаптоэтанолом (Sigma) и стимулировали 0, 11, 33.3 или 100 мкг/мл OVA. Через 3 дня супернатант собирали и анализировали на продукцию IFN-γ, IL-17a и TNF-α с помощью мышиного 4-плекса MSD (специальный набор U-PLEX ELISA, № по каталогу K15069L).

Зависимые от Т-клеток и независимые от Т-клеток В-клеточные ответы

NFAM1 +/+ и NFAM1 -/- мышей иммунизировали NP-CGG (Т-зависимый антиген) или NP-LPS (Т-зависимый антиген). независимый антиген) и через 21 день была проведена вторичная бустерная иммунизация. Образцы крови собирали в дни 0 (до иммунизации), 7, 14, 21 и 28 дней.Сыворотку отделяли и хранили при -80°С до дальнейшего анализа. ELISA IgG выполняли на планшетах, покрытых NP(23)-BSA, с использованием системы клонирования SBA-C57BL/6-HRP (каталожный номер 5300-05B; Southern Biotech) в соответствии с рекомендациями производителя. Набор SBA Clonotyping System-C57BL/6-HRP специально разработан для изотипирования мышиных моноклональных антител C57BL/6 (мышиный IgA, мышиный IgG1, мышиный IgG2b, мышиный IgG2c, мышиный IgG3 и мышиный IgM).

Нуклеофекция моноцитов человека CRISPR

Моноциты, выделенные из РВМС человека, подвергали нуклеофекции комплексами рибонуклеопротеина (РНП) CRISPR с использованием системы нуклеофекции Amaxa 4D в соответствии с инструкциями производителя (Lonza).Подробные протоколы производства RNP были опубликованы ранее (8). Вкратце, лиофилизированную направляющую РНК (gRNA) и tracrRNA (Dharmacon) суспендировали в концентрации 160 мкМ в 10 мМ Tris-HCL, 150 мМ KCl, pH 7,4. 5 мкл 160 мкМ гРНК смешивали с 5 мкл 160 мкМ тракрРНК и инкубировали в течение 30 мин при 37°С. Затем комплексы гРНК: тракрРНК осторожно смешивали с 10 мкл 40 мкМ Cas9 (UC-Berkeley Macrolab) с образованием рибонуклеопротеинов CRISPR-Cas9 (crRNP). Используемые последовательности гРНК следующие:

Нецелевая контрольная гРНК: GGCTCGTTCTACGCACTGA

гРНК NFAM1: GCTGCCCGGGACCCTGCGAC.

Нуклеофицированные моноциты выделяли с помощью культуральной среды RPMI-1640 (Gibco) с добавлением 10% термоинактивированной FBS (Gibco), 50 ед/мл пенициллина и 50 мкг/мл стрептомицина. Эффективность нокаута оценивали с помощью вестерн-блоттинга белка NFAM1. Моноциты стимулировали MegaCD40L (Enzo). Через 24 часа собирали супернатант и анализировали с помощью люминекса с использованием набора Human 38 plex (Millipore, № по каталогу HCYTMAG-60K-PX38).

Получение мышей с нокаутом NFAM1

NFAM1 -/- мышей получали путем инъекции белка Cas9 вместе с проксимальной гРНК (CTAATTGTTCGGCCGGACGC) и дистальной гРНК (AGGGCAGCTACTCTCCCGAG) в зиготы C57BL/6NTac, что приводило к делеции экзонов 2 и 3.Мыши NFAM1 -/- и NFAM1 +/+ были получены для экспериментов путем скрещивания мышей NFAM1 +/- . Колонию мышей NFAM1 +/- поддерживали путем скрещивания мышей NFAM1 +/- с мышами C57BL/6 от Taconic. NFAM1 —/- RAG2 —/- и NFAM1 +/+ RAG2 —/- мышей были созданы для экспериментов против CD40-колита путем скрещивания мышей NFAM1 —/- с RAG2 —/- . мыши (Таконик). Все разведение и генотипирование проводились в Taconic.

Анти-CD40-колит

Для индукции анти-CD40-колита у самцов мышей NFAM1 -/- RAG2 -/- и NFAM1 +/+ RAG2 -/- в возрасте 6-8 недель. вводили 200 мкл внутрибрюшинной инъекции либо 1 мг/мл анти-CD40 (BioXCell клон FGK4.5) в 0,9% хлорида натрия USP (NDC 0409-4888-06), либо только 0,9% хлорида натрия. Массу тела мышей измеряли ежедневно. Мышам, которые достигли 20% потери веса по сравнению с исходным уровнем, вводили 1 мл подкожного физиологического раствора.Мышей, потерявших 25% веса по сравнению с исходным уровнем, подвергали эвтаназии. На 7-й день мышей умерщвляли и брали толстую кишку для гистологии. TNF-α в сыворотке измеряли с помощью набора V-Plex Plus Mouse TNF-α (MSD). IL-1β, IL-6 и IL-12/p70 измеряли с помощью пользовательского MSD U-plex. Все эксперименты на мышах проводились в соответствии с правилами Институционального комитета по уходу за животными и их использованию (IACUC) компании Boehringer Ingelheim.

Гистопатология

Оценка гистопатологии определяется с акцентом на процент поражений.Зафиксированные патологии включают: 1) изменение эпителия слизистой оболочки (потеря бокаловидных сосудов, потеря железы и пролиферация эпителия), 2) эрозии/изъязвления слизистой оболочки и 3) воспаление слизистой оболочки. Сообщается оценка по четырем секциям от каждого животного по каждому параметру. Общий балл представляет собой среднее значение всех трех параметров. Шкала баллов выглядит следующим образом: 0=нормально; 1=минимально большая фокальная площадь или минимальная диффузия; 2 = легкое, диффузное легкое или многоочаговое поражение 11-25%; 3 = Умеренная, поражено от 26 до 50% слизистой оболочки с очаговыми или многоочаговыми изменениями от минимальных до умеренных; 4 = выраженное поражение слизистой оболочки от 51 до 75% с легкими или умеренными изменениями; 5 = тяжелая, поражено от 76 до 100% слизистой оболочки с изменениями от умеренных до выраженных.

Вестерн-блоттинг

Клетки лизировали в буфере RIPA (Thermo Fisher Scientific) с коктейлем ингибиторов протеазы Halt (Thermo Fisher Scientific) и коктейлем ингибиторов фосфатазы (Sigma). Содержание белка определяли с помощью набора для анализа белков Bradford (Thermo Fisher Scientific). Образцы анализировали на NuPAGE, 4-12%, Bis-Tris, Mini Protein Gel, а затем переносили в набор для переноса iBlot с использованием устройства для переноса iBlot (Invitrogen) в соответствии с Техническим руководством Invitrogen Western Blot.Детекцию проводили в соответствии с протоколом вестерн-блоттинга Li-COR Odyssey с использованием первичного антитела α-человеческого NFAM1 (Sigma, кат. № HPA031812) и вторичного антитела α-кролика осла в приборе IRDYE 800CW (LI-COR) в сочетании с инфракрасным сканером Odyssey. (ЛИ-КОР).

Статистические данные

Статистические данные рассчитывались либо с помощью двустороннего критерия Стьюдента (для экспериментов с одним сравнением), либо с помощью обычного однофакторного дисперсионного анализа (для экспериментов с множественными сравнениями). Столбики погрешностей отображают стандартное отклонение.Статистическая значимость изображается следующим образом: **** указывает на значение P <0,0001, *** указывает на значение P <0,001, ** указывает на значение P <0,01 и * указывает на значение P <0,05.

Доступность данных

Данные RNAseq были опубликованы на GSE188390.

Результаты

NFAM1 представляет собой рецептор клеточной поверхности, который активируется при ВЗК и в высокой степени экспрессируется в моноцитах и ​​нейтрофилах

Недавние исследования связывают экспрессию NFAM1 со многими заболеваниями, включая ишемическую болезнь сердца и болезнь Педжета костей (4, 5).Чтобы изучить корреляцию между экспрессией NFAM1 и ВЗК, мы использовали общедоступные наборы данных (6, 7) для оценки экспрессии мРНК NFAM1 в биопсиях кишечника у детей с ВЗК. Мы обнаружили, что экспрессия NFAM1 повышена у пациентов с язвенным колитом (ЯК), болезнью Крона толстой кишки (БК) и болезнью Крона подвздошной кишки (, рисунки 1A, B ). Чтобы идентифицировать типы клеток, которые экспрессируют NFAM1, мы измерили мРНК NFAM1 в иммунных клетках человека. Как сообщалось ранее (1), мРНК NFAM1 высоко экспрессируется в нейтрофилах и моноцитах человека с низкой, но обнаруживаемой экспрессией в Т-клетках, NK-клетках и В-клетках ( Рисунок 1C ). Анализ иммунных клеток, выделенных из селезенки и костного мозга мыши, выявил аналогичный паттерн экспрессии ( Рисунок 1D ) .

Рисунок 1 Экспрессия NFAM1 повышена при ВЗК и может быть обнаружена в клетках врожденной и адаптивной иммунной системы. (A, B) Экспрессия мРНК NFAM1 в биоптатах кишечника из контрольной группы без ВЗК, БК толстой кишки, БК подвздошной кишки или ЯК (данные из общедоступных наборов данных GSE62207 и GSE117993, описание исследования см. в разделе «Методы»). (C) Экспрессия мРНК NFAM1 в человеческих Т-клетках, В-клетках, NK-клетках, моноцитах и ​​нейтрофилах. Показана средняя экспрессия от трех доноров. Данные являются репрезентативными для двух независимых экспериментов. (D) Экспрессия мРНК NFAM1 в мышиных спленоцитах, Т-клетках CD4, Т-клетках CD8, В-клетках, NK-клетках, моноцитах и ​​нейтрофилах. Показана средняя экспрессия трех независимых мышей. Данные являются репрезентативными для двух независимых экспериментов. Во втором эксперименте (данные не показаны) были объединены образцы от 10 отдельных мышей. (E) Экспрессия белка NFAM1 в клетках 293 или клетках 293, трансфицированных кДНК NFAM1. Результаты являются репрезентативными для более чем 5 независимых экспериментов. (F) Экспрессия белка NFAM1 в клетках 293, клетках THP-1, человеческих моноцитах и ​​нейтрофилах человека. Данные являются репрезентативными для трех независимых экспериментов от трех независимых доноров.

Затем мы попытались подтвердить наличие белка NFAM1. Перед этим мы проверили коммерчески доступное антитело против NFAM1, используя клетки 293, трансфицированные кДНК NFAM1.По сравнению с нетрансфицированным контролем мы наблюдали несколько полос около 28 кДа, которые соответствуют предсказанной молекулярной массе NFAM1 в 30 кДа ( Рисунок 1E ). Множественные полосы, вероятно, обусловлены различными уровнями гликозилирования, поскольку NFAM1 имеет предполагаемый сайт N-гликозилирования в своем внеклеточном иммуноглобулиновом домене (1). При вестерн-блот-анализе первичных клеток человека мы наблюдали устойчивую экспрессию NFAM1 в нейтрофилах и моноцитах, что было предсказано на основе экспрессии мРНК.Мы также наблюдали белок NFAM1 в моноцитарной линии клеток THP-1 человека (, рисунок 1F ).

NFAM1 является трансмембранным рецептором типа I, активирующим NFAT. (1) Чтобы проверить экспрессию NFAM1 на клеточной поверхности, мы трансфицировали 293 клетки полноразмерной конструкцией NFAM1, несущей либо N-концевую, либо C-концевую метку FLAG. Мы обнаружили экспрессию FLAG на клеточной поверхности в клетках, которые были трансфицированы N-концевой, но не С-концевой меченой конструкцией, в то время как мы обнаружили внутриклеточный FLAG в клетках, трансфицированных обеими конструкциями ( Дополнительные рисунки 1A, B ). В качестве контроля мы использовали вестерн-блоттинг, чтобы убедиться, что обе конструкции приводят к продукции белка NFAM1 ( Дополнительный рисунок 1C ) . Затем мы стремились подтвердить сообщения о том, что NFAM1 активирует NFAT. Для этого мы использовали подход, подобный описанному Ohtsuka et al., в котором перекрестное связывание химерного белка, содержащего цитоплазматический домен мышиного NFAM1, приводило к активации NFAT. В наших экспериментах мы трансфицировали репортер NFAT, экспрессирующий клетки Jurkat, химерными конструкциями кДНК, состоящими из внеклеточных и трансмембранных доменов CD8α человека, слитых с внутриклеточным доменом либо NFAM1 дикого типа, либо NFAM1 с функционально неактивным ITAM.Мы обнаружили, что трансфекция конструкцией CD8α/NFAM1 дикого типа приводила к спонтанной активации NFAT, которая дополнительно усугублялась перекрестным связыванием с анти-CD8α ( Supplemental Figure 1D ) . Напротив, мы не наблюдали активации NFAT с конструкциями CD8α/мутантный NFAM1. Таким образом, мы подтвердили предыдущие сообщения о том, что NFAM1 представляет собой NFAT-активирующий рецептор клеточной поверхности с N-концевым внеклеточным доменом и C-концевым цитоплазматическим доменом.

NFAM1

-/- У мышей нет явных дефектов развития иммунных клеток или активации В-клеток

На сегодняшний день по NFAM1 опубликовано лишь ограниченное количество статей (1, 2, 4, 5, 9), ни одной из которых использовали мышей с нокаутом как средство понимания функции NFAM1.С этой целью мы создали мышей NFAM1 -/- , используя CRISPR-cas9 для удаления экзонов 2 и 3 ( Рисунок 2A ). Эти мыши не продуцируют наиболее распространенный транскрипт NFAM1 (транскрипт NCBI NM_001271413), в котором используется кодон инициации трансляции, содержащийся в экзоне 2. Однако есть сообщения о дополнительных транскриптах NFAM1, в которых используется кодон инициации трансляции выше по течению в экзоне 1 (NM_028728_3, NM_001271411_1, NM_001271412_1, XM_006521486_2). Для этих транскриптов удаление экзонов 2 и 3 приводит к частичной потере внеклеточного Ig-подобного домена NFAM1.Кроме того, удаление экзонов 2 и 3 приводит к сдвигу рамки от экзона 1 к экзону 4-6.

Рисунок 2 Анализ селезенки мышей NFAM1 +/+ и NFAM1 -/- не выявил различий в процентном содержании врожденных и адаптивных иммунных клеток. Стратегия удаления экзонов 2 и 3 NFAM1 посредством CRISPR-cas9 показана на (A) . Средняя экспрессия экзонов 2 и 3 NFAM1 в спленоцитах и ​​костном мозге мышей 3 NFAM1 +/+ и 3 NFAM1 -/- показана в (B) .Спленоциты были выделены из 4 мышей NFAM1 +/+ и 4 мышей NFAM1 -/- . Среднее количество клеток на селезенку показано на (C) . Процент врожденных и адаптивных иммунных клеток подсчитывали с помощью проточной цитометрии. Средний процент B-клеток на селезенку показан в (D) , средний процент NK-клеток, миелоидных дендритных клеток (mDC), нейтрофилов (нейтр) и моноцитов (моно) в селезенке показан в (E) , средний процент Т-клеток CD4 показан в (F) , а средний процент Т-клеток CD8 показан в (G) . (C–G) Результаты представляют два независимых эксперимента. Во втором эксперименте (данные не представлены) были проанализированы селезенки от 9 мышей NFAM1 -/- и 6 мышей NFAM1 +/+ без статистически значимых различий в процентном содержании врожденных или адаптивных иммунных клеток между NFAM1 +/+ и NFAM1 -/- мышей.

Мы использовали RT-qPCR для подтверждения делеции экзонов 2 и 3 ( Рисунок 2B ), , поскольку мы обнаружили, что имеющиеся в продаже антитела против NFAM1 человека не вступают в перекрестную реакцию с мышиным NFAM1.Кроме того, попытки генерировать наши собственные антитела путем иммунизации кроликов слитым белком NFAM1 Fc мыши не увенчались успехом (данные не показаны). После подтверждения делеции на уровне мРНК мы провели проточную цитометрию, чтобы определить, влияет ли делеция NFAM1 на развитие иммунных клеток. Ранее сообщалось, что перенос клеток-предшественников костного мозга со сверхэкспрессией NFAM1 мышам дикого типа приводит к резкому снижению количества зрелых В-клеток селезенки (2). Напротив, мы обнаружили, что мыши NFAM1 -/- имели нормальное количество клеток в селезенке ( Рисунок 2C ) и не изменяли процент IgM-положительных, IgD-положительных, IgM/IgD-положительных двойных или IgM/IgD-положительных. двойные отрицательные В-клетки ( Рисунок 2D ) .Эти данные показывают, что хотя избыточная экспрессия NFAM1 может нарушать созревание В-клеток, эндогенный NFAM1 не играет значительной роли в развитии В-клеток. Точно так же мы обнаружили, что у мышей NFAM1 -/- не было значительных изменений в процентном содержании селезеночных дендритных клеток, моноцитов, нейтрофилов, NK-клеток или CD4 + или CD8 + наивных, центральной памяти или эффекторных Т-клеток памяти. ( Рисунки 2E–G ).

Хотя мы не наблюдали роли NFAM1 в стимулировании развития В-клеток, нам было любопытно, способствует ли NFAM1 опосредованной В-клетками продукции антител.Чтобы определить, вызывают ли мыши NFAM1 -/- нормальный Т-клеточно-независимый и Т-клеточно-зависимый В-клеточный ответ, мы иммунизировали мышей в дни 0 и 21 конъюгированным гаптеном (4-гидрокси-3-нитрофенил) ацетил (NP). к LPS или куриному γ-глобулину (CGG). Иммунный ответ оценивали в несколько моментов времени путем измерения титров антител, специфичных к NP. Все иммунизированные мыши демонстрировали сходные уровни продукции NP-специфических IgG1 и IgG2c после иммунизации Т-зависимым антигеном, NP-CGG (, фигура 3A ). Аналогичным образом, у мышей NFAM1 +/+ и NFAM1 -/- не было обнаружено статистически значимой разницы в продукции NP-специфических IgG3 и IgM после стимуляции Т-независимым антигеном, NP-LPS ( Фигура 3B ). Эти данные указывают на то, что помимо того, что эндогенный NFAM1 не влияет на развитие В-клеток, он мало влияет на активацию В-клеток или образование антител.

Рисунок 3 NFAM1 -/- Мыши не имеют значительных дефектов Т-клеточно-зависимого или Т-клеточно-независимого В-клеточного ответа. (A) Мышей иммунизировали NP-CGG в дни 0 и 21. Показаны сывороточные IgG1 и IgG2c. Данные были объединены из двух независимых экспериментов для 11 мышей NFAM1 +/+ и 11 мышей NFAM1 -/- на момент времени. (B) Мышей иммунизировали NP и LPS в дни 0 и 21. Показаны сывороточные IgG3 и IgM. Данные были объединены из двух независимых экспериментов. Показано среднее значение для 6 мышей NFAM1 +/+ и 6 мышей NFAM1 -/- на 0, 7 и 14 дни и среднее значение для 10 мышей NFAM1 +/+ и 10 мышей NFAM1 -/- на 21 день. и 28.NS указывает на то, что разница между образцами NFAM1 +/+ и NFAM1 -/- не является статистически значимой.

NFAM1

-/- Моноциты демонстрируют пониженную продукцию провоспалительных цитокинов в ответ на множественные стимулы, связанные с ВЗК

Затем мы исследовали роль NFAM1 в активации моноцитов, поскольку моноциты экспрессируют высокие уровни NFAM1 и Было показано, что моноцитарная клеточная линия влияет на функциональные показания, такие как хемотаксис (5).Поскольку нас интересует роль NFAM1 при ВЗК, мы проверили влияние делеции NFAM1 на реакцию на микробные стимулы, поскольку дисбиоз кишечника является основным фактором патогенеза ВЗК (10). Для этого мы выделили моноциты из костного мозга мышей NFAM1 +/+ и NFAM1 -/- , примировали моноциты IFN-γ, а затем стимулировали клетки целыми бактериями или микробными компонентами. Мы обнаружили, что моноциты NFAM1 -/- демонстрируют снижение продукции TNF-α в ответ на стимуляцию убитыми нагреванием Escherichia coli (HKEB), убитыми нагреванием Listeria monocytogenes (HKLM) и убитыми нагреванием Salmonella typhimurium. (HKST) ( Рисунки 4A–C ). Мы наблюдали тенденцию к снижению продукции TNF-α с лигандом TLR4 LPS и зимозаном , обедненным лигандом dectin-1 (, рисунки 4D, F ), , но эти различия не достигли статистической значимости. Важно отметить, что мы наблюдали заметное снижение продукции TNF-α в ответ на стимуляцию лигандом TLR1/2 Pam3CSK4, лигандом TLR2/6 FSL1 и лигандом NOD2 MDP (, рисунки 4E, G, H ). Снижение ответа на MDP имеет особое значение для ВЗК, поскольку мутации CARD15 /NOD2 связаны с БК (11).Наконец, мы исследовали реакцию на CD40L, поскольку было показано, что введение анти-CD40 in vivo вызывает патологию, подобную ВЗК, у мышей (12), а CD40L экспрессируется Т-клетками, которые, как известно, играют значительную роль в ВЗК. патогенез (13). Как и при микробных стимулах, моноциты NFAM1 -/- также продуцировали сниженный TNF-α при стимуляции CD40L (Фигура 4I ).

Рисунок 4 NFAM1 -/- моноциты продуцируют сниженный уровень TNF-α в ответ на активацию множественными стимулами, связанными с ВЗК.Моноциты были выделены из 6 мышей NFAM1 +/+ и 6 мышей NFAM1 -/- . Моноциты примировали IFN-γ и стимулировали HKEB, HKLM, HKST, LPS, Pam3CSK4, зимозаном, FSL-1, MDP и CD40L в течение 48 часов. Средняя продукция TNF-α показана в (A-I) . Данные HKEB, HKLM, HKST, Pam3CSK4 и FSL-1 являются репрезентативными для двух независимых экспериментов, в которых моноциты NFAM1 -/- продуцировали сниженный TNF-α в ответ по меньшей мере на одну концентрацию каждого стимула. Данные по ЛПС и зимозану являются репрезентативными для 3 независимых экспериментов, в которых последовательно отсутствовали статистически значимые различия между продукцией TNF-α в моноцитах NFAM1 +/+ и NFAM1 -/- .Данные MDP и CD40L являются репрезентативными для 3 независимых экспериментов, в которых моноциты NFAM1 -/- продуцировали сниженный TNF-α в ответ на множественные концентрации MDP и CD40L. Статистическая значимость представлена ​​следующим образом: **** указывает значение P <0,0001, *** указывает значение P <0,001, ** указывает значение P <0,01, * указывает значение P <0,05 и ns указывает на то, что сравнение не является статистически значимым.

Таким образом, эти данные показывают, что NFAM1 на моноцитах мыши способствует выработке TNF-α в ответ на множественные стимулы, связанные с ВЗК.Однако, учитывая, что моноциты были обработаны IFN-γ, который, как известно, потенцирует выработку провоспалительных цитокинов (14), также возможно, что NFAM1 регулирует чувствительность к IFN-γ, не оказывая прямого влияния на реакцию на микробные стимулы или CD40L. . Чтобы дополнительно изучить роль NFAM1, мы стимулировали моноциты только IFN-γ, только CD40L или IFN-γ плюс CD40L. Мы обнаружили, что IFN-γ потенцирует CD40L-индуцированную продукцию TNF-α как в моноцитах NFAM1 +/+ , так и в моноцитах NFAM1 -/- .Напротив, мы наблюдали снижение продукции TNF-α в моноцитах NFAM1 -/- , стимулированных как одним CD40L, так и IFN-γ плюс CD40L (, дополнительная фигура 2 ). Эти результаты показывают, что снижение TNF-α, которое мы наблюдали в ответ на множественные стимулы, не связано с дефектным праймированием IFN-γ.

Затем мы попытались определить, влияет ли NFAM1 на активацию моноцитов помимо продукции TNF-α, например, на продукцию дополнительных цитокинов и хемокинов и активацию маркеров клеточной поверхности.Мы сосредоточились на ответе на IFN-γ плюс CD40L, поскольку эти стимулы приводят к очень значимой разнице в продукции TNF-α между моноцитами NFAM1 +/+ и NFAM1 -/- . При стимуляции IFN-γ плюс CD40L мы обнаружили, что моноциты NFAM1 -/- продуцируют значительно сниженные уровни IL-6, IL-12, MIP-1α/CCL3 и MIP-1β/CCL4 (, рисунки 5A–D ). . Напротив, при анализе экспрессии маркеров клеточной поверхности мы наблюдали лишь незначительное снижение активации CD86 и отсутствие различий в активации CD80, MHC-I, MHC-II и CD40 ( Фигуры 5E–I ) , что указывает на то, что NFAM1 модулирует только некоторые аспекты CD40L-индуцированной активации моноцитов.

Рисунок 5 При стимуляции с помощью CD40L моноциты NFAM1 -/- демонстрируют сниженную выработку множества провоспалительных цитокинов и хемокинов, но почти не имеют дефекта в положительной регуляции маркеров активации клеточной поверхности. (A–D) Моноциты от 4 мышей NFAM1 +/+ и 4 мышей NFAM1 -/- примировали IFN-γ и стимулировали CD40L в течение 48 часов. Средние уровни IL-6, IL-12, MIP-1α и MIP-1β показаны на (A–D) соответственно. (Э-И) . Моноциты от 6 мышей NFAM1 +/+ и 6 мышей NFAM1 -/- примировали IFN-γ и стимулировали CD40L в течение 24 часов. Средняя экспрессия CD86, CD80, MHC-I, MHC-II и CD40 показана в (E-I) соответственно. Данные о цитокинах и хемокинах являются репрезентативными для трех независимых экспериментов. Данные экспрессии клеточной поверхности являются репрезентативными для двух независимых экспериментов. Статистическая значимость представлена ​​следующим образом: **** означает значение P <0.0001, ** указывает на значение P <0,01, а ns указывает на то, что сравнение не является статистически значимым.

Чтобы лучше понять влияние делеции NFAM1 на активацию моноцитов, мы провели полный транскриптомный анализ моноцитов, которые культивировали в присутствии или в отсутствие IFN-γ плюс CD40L в течение 6 или 24 часов. Анализ обогащения пути KEGG показал, что по сравнению с моноцитами NFAM1 +/+ , моноциты NFAM1 -/- , которые стимулировались IFN-γ плюс CD40L в течение 6 часов, имели сниженную экспрессию генов, связанных с несколькими путями, включая IBD, передачу сигналов TNF. , передача сигналов NF-kB и взаимодействие цитокинов и цитокинов 90–120 (, рисунок 6 ) 90–122.Примечательно, что в 6-часовой момент времени данные RNAseq подтвердили то, что мы наблюдали на уровне белка: делеция NFAM1 снижала индуцированную CD40L экспрессию IL-12, IL-6, Ccl4, Ccl3 и TNF (, рис. 7A–F ) , но оказывает лишь очень незначительное влияние на экспрессию CD86 и CD40 ( Дополнительные рисунки 3B, C ) и не влияет на экспрессию CD80, h3-D1 и h3-Q7 ( Дополнительные рисунки 3A , Д, Е ) . Кроме того, мы наблюдали, что NFAM1 способствует индуцированной CD40L экспрессии дополнительных провоспалительных медиаторов, включая IL-1a, Ccl22 и лимфотоксин-α (LTA), а также Cdk5r1 (, рисунки 7G–J ). Помимо регуляции провоспалительных медиаторов, моноциты NFAM1 -/- также снижали индуцированную CD40L экспрессию антиапоптотических молекул Bcl2a1a, Bcl2a1b и Bcl2a1d (, рисунки 7K–M ). Наконец, нестимулированные моноциты NFAM1 -/- имели небольшое, но значимое снижение экспрессии факторов транскрипции, включая Nfkb1 и Nr4a1 ( Фигуры 7N, O ).

Рисунок 6. Анализ пути KEGG подтверждает дифференциальную экспрессию генов между моноцитами NFAM1 +/+ и NFAM1 -/- .Моноциты от 4 мышей NFAM1 +/+ и 6 мышей NFAM1 -/- не стимулировали или стимулировали IFN-γ и CD40L. РНК выделяли и анализировали с помощью RNAseq через 6 и 24 часа. Показан KEGG-анализ генов с повышенной экспрессией в моноцитах NFAM1 +/+ по сравнению с моноцитами NFAM1 -/- .

Рисунок 7 Анализ RNAseq подтверждает, что в моноцитах NFAM1 -/- снижена экспрессия CD40L-индуцированных провоспалительных цитокинов и хемокинов.RNAseq выполняли, как описано на рисунке 6. Среднее значение FPKM для выбранных генов через 6 часов показано как (A–O) . Статистическая значимость представлена ​​следующим образом: **** указывает значение P <0,0001, *** указывает значение P <0,001, ** указывает значение P <0,01 и * указывает значение P <0,05.

Обнаружив, что NFAM1 способствует выработке IL-12, нам было любопытно узнать, нарушена ли у мышей NFAM1 -/- способность продуцировать Th2-ассоциированный цитокин IFN-γ, поскольку известно, что IL-12 управляет Т-клетками. дифференцировка в сторону фенотипа Th2.Поэтому мы иммунизировали мышей NFAM1 +/+ и NFAM1 -/- с помощью OVA, эмульгированного в CFA, и провели рестимуляции ex-vivo на 10-й день. Мы не наблюдали снижения продукции IFN-γ, IL-17 или TNF. -α клетками, выделенными из NFAM1 -/- мышей ( Дополнительный рисунок 5 ), , что указывает на то, что в этих условиях иммунизации NFAM1 не способствует развитию клеток Th2 или Th27. Моноциты являются лишь одним из многих типов клеток, которые могут продуцировать IL-12.Поэтому возможно, что отсутствие дефекта в развитии клеток Th2 является результатом компенсаторной продукции IL-12 другими типами миелоидных клеток. Чтобы проверить, влияет ли делеция NFAM1 на продукцию провоспалительных цитокинов в макрофагах, мы выделили индуцированные тиогликолатом перитонеальные макрофаги от мышей NFAM1 +/+ и NFAM1 -/- и стимулировали клетки с помощью IFN-γ и CD40L. Мы обнаружили, что перитонеальные макрофаги мышей NFAM1 -/- продуцировали сниженные уровни TNF-α ( Дополнительный рисунок 4 ), , хотя величина снижения была не такой резкой, как наблюдаемая у NFAM1 -/- . моноциты.

Затем мы спросили, способствует ли NFAM1 выработке провоспалительных цитокинов и хемокинов в моноцитах человека. Для этого мы использовали CRISPR-RNP для удаления NFAM1, что привело к значительному снижению экспрессии белка NFAM1 по данным вестерн-блоттинга. Используя экспрессию мРНК в качестве показателя, мы наблюдали, что NFAM1 CRISPR-RNP снижает CD40L-опосредованную индукцию экспрессии мРНК CCL4 у пяти независимых доноров (, рисунок 8 ). Кроме того, у донора 6 th мы продемонстрировали, что NFAM1 CRISPR-RNP снижает опосредованную CD40L продукцию MIP-1β/CCL4, TNF-α, IL-8, IL-1β, IL-1Ra и белка CCL22 ( Дополнительный рисунок 6 ). Эти результаты показывают, что роль NFAM1 в стимулировании активации моноцитов сохраняется у мыши и человека. Кроме того, это предполагает, что сниженная способность моноцитов NFAM1 -/- реагировать на стимулы, такие как CD40L, не является результатом дефекта развития, поскольку мы смогли воспроизвести эти результаты, используя острую делецию NFAM1 в моноцитах человека.

Рисунок 8 NFAM1 способствует индуцированной CD40L продукции CCL4 в моноцитах человека. (A–E) Человеческие моноциты были выделены от 5 независимых доноров и обработаны нецелевым (NT) CRISPR-RNP или NFAM1 CRISPR-RNP.Клетки высевали в двух экземплярах и стимулировали CD40L. Показаны экспрессия белка NFAM1 и экспрессия мРНК CCL4.

В модели колита, индуцированного анти-CD40, NFAM1

-/- Мыши демонстрируют пониженные уровни TNF-α в сыворотке

Наконец, мы исследовали роль NFAM1 в развитии колита in vivo . Мы выбрали модель анти-CD40, которая обычно используется для изучения роли врожденной иммунной системы в развитии воспаления кишечника и, как известно, обусловлена ​​продукцией IL-1β, IL-23 и IL-12 миелоидными клетками (12). ).Эта модель является очевидным выбором, учитывая, что моноциты NFAM1 -/- продуцируют уменьшенный IL-12 при стимуляции CD40L. Модель колита против CD40 запускали на фоне RAG -/- , поэтому мы сначала создали мышей NFAM1 +/+ RAG -/- и NFAM1 -/- RAG -/- . При введении анти-CD40 NFAM1, по-видимому, не способствует развитию патологии толстой кишки, о чем свидетельствуют потеря веса, изменения эпителия, потеря желез слизистой оболочки и воспаление (, рисунки 9A–E ). Мы также не наблюдали статистически значимого снижения уровней IL-1β, IL-6 или IL-12 в сыворотке ( Фигуры 9G-I ). Однако мы наблюдали снижение уровня TNF-α в сыворотке у мышей NFAM1 -/- , которым вводили анти-CD40, по сравнению с контрольной группой NFAM1 +/+ ( Рисунок 9F ). Эти результаты показывают, что, хотя NFAM1 не является основным фактором повреждения кишечника в модели анти-CD40, NFAM1 действительно влияет на продукцию провоспалительного TNF-α.

Рисунок 9 Индукция анти-CD40-колита у мышей NFAM1 -/- приводит к снижению выработки TNF-α, но не приводит к существенным различиям в развитии патологии кишечника. (A–I) 9 NFAM1 +/+ RAG2 -/- мышей и 9 NFAM1 -/- RAG2 -/- мышей вводили физиологический раствор и взвешивали в дни 0 и 7. 11 NFAM1 +/+ RAG2 -/- мышей и 12 мышей NFAM1 -/- RAG2 -/- мышей инъецировали анти-CD40 и взвешивали ежедневно в дни 0-7.Средний процент исходной массы тела показан в (A) . Средние баллы патологии кишечника показаны в (B) , средние баллы изменения эпителия показаны в (C) , средние баллы воспаления показаны в (D) , средние баллы потери слизистой железы показаны в (E ) . Сывороточные TNF-α, IL-1β, IL-6 и IL-12 показаны в (F-I) соответственно. Данные являются репрезентативными для двух независимых экспериментов. Во втором эксперименте (данные не показаны) также наблюдалось статистически значимое снижение анти-CD40-индуцированной продукции TNF-α у мышей NFAM1 -/-.Статистическая значимость представлена ​​следующим образом: * указывает на значение P <0,05, а ns указывает на то, что сравнение не является статистически значимым.

Обсуждение

Основная цель настоящего исследования состояла в том, чтобы дать представление о роли NFAM1 в ВЗК, поскольку мы наблюдали, что экспрессия NFAM1 в значительной степени индуцируется в биоптатах пациентов с ВЗК. Наш подход заключался в создании мышей NFAM1 -/- в качестве средства лучшего понимания функции NFAM1. Мы наблюдали, что NFAM1 способствует выработке провоспалительных цитокинов и хемокинов в CD40L-стимулированных моноцитах мыши и человека, а также перитонеальных макрофагах мыши.Несмотря на роль NFAM1 в стимулировании CD40L-опосредованной активации, мыши NFAM1 -/- не защищены от развития анти-CD40-колита. Тем не менее, мы наблюдали снижение уровня TNF-α в сыворотке, предполагая, что, хотя NFAM1 не является основным фактором ВЗК, NFAM1 действительно способствует воспалению и, следовательно, может способствовать заболеванию человека.

Насколько нам известно, настоящее исследование является первым фенотипом мышей NFAM1 -/- . Примечательно, что мы наблюдали, что мыши NFAM1 -/- имеют нормальное количество В-клеток селезенки и не имеют явных дефектов в продукции антител, опосредованной В-клетками.Эти наблюдения важны, потому что NFAM1 обычно называют регулятором передачи сигналов В-клеток (4, 5, 15-17). Связь NFAM1 с передачей сигналов В-клеток была обнаружена в исследовании Ohtsuka et al. в котором сообщалось, что NFAM1 блокирует развитие В-клеток (2). Разница в результатах нашего исследования и результатов Ohtsuka et al. вероятно, из-за различных методологий, используемых для исследования функции NFAM1. Хотя мы исследовали влияние удаления NFAM1, Ohtsuka et al. создали трансгенных мышей, которые сверхэкспрессируют NFAM1 в гемопоэтическом отделе.Одним важным ограничением последнего подхода является то, что сверхэкспрессия трансмембранных рецепторов может индуцировать спонтанную кластеризацию, которая способствует лиганд-независимой передаче сигнала. Таким образом, свидетельство того, что сверхэкспрессия NFAM1 блокирует развитие В-клеток, не следует интерпретировать как доказательство того, что эндогенный NFAM1 играет аналогичную роль. Хотя мы не можем окончательно заключить, что NFAM1 не обладает внутренней активностью В-клеток, поскольку мы провели относительно грубый анализ субпопуляций периферических В-клеток, а также продукции антител, опосредованной В-клетками, наши результаты убедительно свидетельствуют о том, что NFAM1 не играет важной роли в В-клетках. функция клетки.

Вторым важным открытием настоящего исследования является наблюдение, что NFAM1 способствует воспалению, опосредованному моноцитами. Исследования Лонга и соавт. также сообщают, что NFAM1 играет активирующую роль на моноцитах (5). Однако, хотя мы наблюдали, что NFAM1 способствует индуцированной CD40L продукции цитокинов и хемокинов, Long et al. сообщают, что NFAM1 способствует экспрессии рецепторов хемокинов, включая CCR2, CCR5 и CX3CR1, ни один из которых не снижен в моноцитах мыши NFAM1 -/- .Разница в результатах наших исследований и исследований Long et al. может быть связано с различиями в используемых типах клеток. Эксперименты Long et al. были выполнены на клеточных линиях U-937 и THP-1. Напротив, в наших исследованиях использовались первичные моноциты мыши и человека, и поэтому они могут более точно описать роль NFAM1 в заболевании человека. Кроме того, Лонг и соавт. использовали shRNA и siRNA в качестве средства нокдауна NFAM1, в то время как мы получили NFAM1 -/- мышей. Преимущество использования мышей с нокаутом состоит в том, что они обеспечивают гомогенную популяцию моноцитов с полным нокдауном NFAM1.Независимо от различий в конкретных генах-мишенях, которые модулировались NFAM1, как наши результаты, так и результаты Long et al. указывают на то, что NFAM1 способствует активации моноцитов, что требует дальнейшего изучения роли NFAM1 в заболеваниях человека.

В настоящих исследованиях мы приводим доказательства того, что делеция NFAM1 снижает выработку провоспалительных цитокинов CD40L-стимулированными моноцитами. Мы также наблюдали, что делеция NFAM1 вызывает значительное, хотя и менее глубокое, снижение продукции TNF перитонеальными макрофагами, стимулируемыми CD40L.По сравнению с моноцитами относительно слабое влияние делеции NFAM1 на перитонеальные макрофаги может быть результатом образования клеток в сильно провоспалительной среде, вызванной внутрибрюшинной инъекцией тиогликолята. Возможно, что эта провоспалительная среда подавляет потребность в NFAM1. Дополнительные эксперименты с макрофагами, происходящими из костного мозга, обеспечат дальнейшее понимание роли NFAM1 в активации макрофагов и станут предметом будущих исследований.

Помимо моноцитов и макрофагов, NFAM1 экспрессируется многими типами клеток, которые не были объектом исследования. Например, мы наблюдали, что NFAM1 в высокой степени экспрессируется как мышиными, так и человеческими нейтрофилами ( Фигуры 1C, D ) , и сообщается, что NFAM1 экспрессируется как остеокластами, так и преостеокластами. В модели PDB in vitro , опосредованной белком вируса кори, NFAM1 способствует развитию остеокластов и резорбции кости (4). Интересно, что аналогично нашим наблюдениям в моноцитах NFAM1 -/- , кшРНК NFAM1 снижает RANKL-индуцированную экспрессию IL-6 и TNF-α в преостеокластной клеточной линии RAW264.7 (9). Вместе эти данные свидетельствуют о том, что NFAM1 способствует экспрессии провоспалительных цитокинов и хемокинов во многих типах клеток.

Остается важный вопрос: как NFAM1 способствует продукции провоспалительных цитокинов и хемокинов? NFAM1 представляет собой трансмембранный рецептор, содержащий цитоплазматический ITAM. При сверхэкспрессии в клеточных линиях мы и другие (1, 5) сообщили, что NFAM1 запускает активацию кальций-активируемого транскрипционного фактора NFAT. (18) Еще раз подтверждая связь между NFAM1 и NFAT, нокдаун NFAM1 в пре-остеокластах снижает внутриклеточные колебания кальция и активацию NFATc1, тем самым уменьшая развитие остеокластов (4, 9). снижение экспрессии нескольких генов-мишеней NFAT, включая TNF-α (19), IL-12 (20), лимфотоксин-α (21), Cdk5r1 (22), Bcl2 (23) и Nr4a1 (24).

Хотя NFAT наиболее известен своей ролью в регуляции активации Т-клеток, недавние открытия показали, что NFAT также регулирует активацию врожденных иммунных клеток. Например, NFAT способствует бактериальной и грибковой активации макрофагов, дендритных клеток и моноцитов (3, 25, 26). Кроме того, есть сообщения о том, что NFAT конститутивно активируется в макрофагах, что приводит как к усилению ответов TLR, так и к неадекватной продукции цитокинов, вызывающей заболевание (18). Примечательно, что мы наблюдали, что моноциты NFAM1 -/- снижали экспрессию Nr4a1 в отсутствие стимуляции CD40L, что позволяет предположить, что NFAM1 может способствовать конститутивной активации NFAT.Чтобы определить условия, при которых NFAM1 запускает активацию NFAT, важно определить, связывается ли NFAM1 со специфическим лигандом, поскольку рецепторы, содержащие ITAM, обычно активируются путем перекрестного связывания. Эксперименты по идентификации потенциальных лигандов NFAM1, а также изучение нижестоящей передачи сигналов станут темой будущих исследований.

Наконец, мы проверили влияние делеции NFAM1 на развитие колита, индуцированного анти-CD40. Удивительно, но мы не наблюдали защиты от развития патологии толстой кишки, измеряемой потерей веса, изменениями эпителия, потерей слизистой железы и воспалением.Кроме того, несмотря на резкое снижение продукции провоспалительных цитокинов в CD40L-стимулированных моноцитах NFAM1 -/- , мы наблюдали лишь незначительное снижение сывороточных уровней TNF-α и отсутствие снижения сывороточных уровней IL-1β, IL-6. или Ил-12. Существует несколько возможных объяснений несоответствия между нашими результатами in vitro и in vivo . Во-первых, наши эксперименты in vitro были сосредоточены на роли NFAM1 в моноцитах, в то время как существует несколько типов клеток, которые способствуют анти-CD40-колиту, не на все из которых может повлиять делеция NFAM1.Более того, роль NFAM1 может зависеть от контекста. В поддержку этой гипотезы тиогликолат-индуцированные перитонеальные макрофаги мышей NFAM1-/- показали лишь незначительное снижение CD40L-индуцированной продукции TNF-α, что позволяет предположить, что роль NFAM1 может быть уменьшена в провоспалительной среде. Дальнейшее изучение роли NFAM1 в дополнительных типах клеток и провоспалительных параметрах позволит лучше понять роль NFAM1 в заболевании.

Таким образом, мы продемонстрировали, что NFAM1 способствует провоспалительным реакциям в моноцитах, стимулированных in vitro , и оказывает умеренное влияние на продукцию TNF-α in vivo .Эта новая роль NFAM1 требует дальнейшего изучения роли NFAM1 в дополнительных аутоиммунных заболеваниях.

Заявление о доступности данных

Наборы данных, представленные в этом исследовании, можно найти в онлайн-репозиториях. Названия репозитория/репозиториев и инвентарные номера можно найти в статье/дополнительных материалах.

Заявление об этике

Исследования с участием людей были проверены и одобрены Sanford Burnham Prebys Medical Discovery Institute, La Jolla, CA и Boehringer Ingelheim Pharmaceuticals, Inc., 900 Риджбери-роуд, Риджфилд, Коннектикут. Пациенты/участники предоставили письменное информированное согласие на участие в этом исследовании. Исследование на животных было рассмотрено и одобрено Институциональным комитетом по уходу за животными и их использованию в Институте медицинских открытий Sanford Burnham Prebys, Ла-Хойя, Калифорния, и Boehringer Ingelheim Pharmaceuticals, Inc., 900 Ridgebury Road, Ridgefield, CT, США.

Авторские вклады

KJ спроектировал эксперименты, провел исследование, проанализировал данные и написал статью.AG разработала эксперименты, провела исследования, проанализировала данные и внесла свой вклад в написание статьи. JL и SC разработали эксперименты и внесли свой вклад в написание статьи. Эксперименты, разработанные МЛМ. JPG, ES, NY, NJH, ACM, SEF, SSW, ERAG и IY провели исследования и проанализировали данные. DS разработала эксперименты, провела исследования и проанализировала данные. JR разработал конструкции ДНК NFAM1. LL проанализировала данные RNAseq. JZ забил образцы патологии. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Эта работа финансировалась в рамках соглашения о сотрудничестве в области исследований с Boehringer Ingelheim Pharmaceuticals, Inc. и Институтом медицинских открытий Sanford Burnham Prebys.

Конфликт интересов

SC выступал в качестве главного исследователя контракта. KWJ, JPG, ES, ACM, SEF, DS, SSW, ERAG, IY, JR, LL, JZ, MLM и JL были сотрудниками Берингер Ингельхайм.

Авторы сообщают, что финансовая поддержка этого проекта была предоставлена ​​компанией Boehringer Ingelheim посредством исследовательского контракта с Институтом медицинских открытий Sanford Burnham Prebys.«Берингер Ингельхайм» принимала участие в исследовании: разработка эксперимента, сбор данных, анализ и написание статьи.

Примечания издателя

Все претензии, изложенные в этой статье, принадлежат исключительно авторам и не обязательно представляют претензии их дочерних организаций или издателя, редакторов и рецензентов. Любой продукт, который может быть оценен в этой статье, или претензии, которые могут быть сделаны его производителем, не гарантируются и не поддерживаются издателем.

Благодарности

Мы благодарим Руби Васти за поддержку проточной цитометрии.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fimmu.2021.773445/full#supplementary-material

Дополнительный рисунок 1 | NFAM1 представляет собой трансмембранный рецептор типа I, активирующий NFAT. (A–C) Клетки 293 трансфицировали либо немеченым NFAM1, либо NFAM1, несущим либо N-концевую, либо C-концевую FLAG-метку.Окрашивание клеточной поверхности против FLAG показано на (A) . Внутриклеточное окрашивание анти-FLAG показано в (B) . Вестерн-блоттинг анти-NFAM1 показан под номером (C) . Данные являются репрезентативными для двух независимых экспериментов. Клетки Jurkat, экспрессирующие репортер люциферазы NFAT, трансфицировали конструкциями ДНК, кодирующими внеклеточный и трансмембранный домен CD8α, слитый с цитоплазматическим доменом NFAM1 дикого типа или NFAM1 с инактивированным ITAM. После трансфекции клетки культивировали в отсутствие или в присутствии анти-CD8α.Активность люциферазы показана в (D) . Данные являются репрезентативными для двух независимых экспериментов. Статистическая значимость представлена ​​следующим образом: **** означает значение P <0,0001.

Дополнительный рисунок 2 | NFAM1 -/- моноциты продуцируют сниженный уровень TNF-α в ответ на стимуляцию CD40L, независимо от того, были ли клетки примированы IFN-γ. Моноциты от 6 мышей NFAM1 +/+ и 6 мышей NFAM1 -/- . стимулировали CD40L с праймированием IFN-γ или без него.Показано количественное определение TNF-α в супернатанте через 48 часов. Данные являются репрезентативными для двух независимых экспериментов. Статистическая значимость изображается следующим образом: **** указывает на значение P <0,0001, * указывает на значение P <0,05 и ns указывает на то, что сравнение не является статистически значимым.

Дополнительный рисунок 3 | Анализ RNAseq подтверждает, что моноциты NFAM1 -/- практически не имеют дефектов CD40L-индуцированной экспрессии CD80, CD86, CD40, MHC-I и MHC-II.Моноциты от 4 мышей NFAM1 +/+ и 6 мышей NFAM1 -/- не стимулировали или стимулировали IFN-γ и CD40L. РНК выделяли и анализировали с помощью RNAseq через 6 и 24 часа. Среднее значение FPKM для выбранных генов через 6 часов показано в (A–E) . Статистическая значимость представлена ​​следующим образом: ** указывает на значение P <0,01, а ns указывает на то, что сравнение не является статистически значимым.

Дополнительный рисунок 4 | Индуцированные тиогликолатом перитонеальные макрофаги мышей NFAM1 -/- продуцируют сниженный уровень TNF-α в ответ на стимуляцию IFN-γ и CD40L.Мышам 4 NFAM1 +/+ и 4 NFAM1 -/- внутрибрюшинно вводили 3% тиогликолят. На 3-й день мышей умерщвляли, собирали перитонеальный лаваж и выделяли макрофаги с помощью центрифугирования. Показан количественный анализ TNF-α в супернатанте через 48 часов после стимуляции IFN-γ и CD40L. Данные объединены из двух независимых экспериментов для 8 мышей NFAM1+/+ и 8 мышей NFAM1-/-. Статистическая значимость представлена ​​следующим образом: * указывает на значение P <0.05 и ns указывают на то, что сравнение не является статистически значимым.

Дополнительный рисунок 5 | Нет существенной разницы в продукции цитокинов, опосредованной Т-клетками, у мышей NFAM1 -/- и NFAM1 +/+ . (A–C) 10 NFAM1 -/- и 10 NFAM1 +/+ мышей иммунизировали в основание хвоста OVA, эмульгированным в полном адъюванте Фрейнда. На 10-й день выделяли паховые лимфатические узлы и повторно стимулировали 0, 11, 33.3 или 100 мкг/мл OVA. Средняя продукция IFN-γ показана в (A) , средняя продукция IL-17 показана в (B) , а средняя продукция TNF-α показана в (C) . Данные являются репрезентативными для двух независимых экспериментов. NS указывает на то, что сравнение не является статистически значимым.

Дополнительный рисунок 6 | NFAM1 способствует индуцированной CD40L продукции цитокинов и хемокинов в моноцитах человека. (A–G) Моноциты человека от 1 донора обрабатывали нецелевым (NT) CRISPR-RNP или NFAM1 CRISPR-RNP.Клетки высевали в двух повторностях и стимулировали CD40L в течение 24 часов. Показаны экспрессия белка NFAM1 (A) и MIP-1β (B) , TNF-α (C) , IL-8 (D), IL-1β (E) , IL-1Ra (F) и CCL22 (G) , измеренные в супернатанте с помощью luminex.

Ссылки

1. Yang J, Hu G, Wang S-W, Li Y, Martin R, Li K, et al. Белок, активирующий кальциневрин/ядерные факторы активированных Т-клеток (NFAT), и иммунорецепторный мотив активации на основе тирозина (ITAM) (CNAIP), новый белок, содержащий ITAM, который активирует сигнальный путь кальциневрина/NFAT*. J Biol Chem (2003) 278:16797–801. doi: 10.1074/jbc.M211060200

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

2. Оцука М., Арасэ Х., Такеучи А., Ямасаки С., Сиина Р., Суэнага Т. и др. NFAM1, иммунорецепторная молекула, несущая мотив активации на основе тирозина, которая регулирует развитие В-клеток и передачу сигналов. Proc Natl Acad Sci USA (2004) 101:8126–31. doi: 10.1073/pnas.0401119101

PubMed Abstract | Полный текст перекрестной ссылки | Академия Google

3.Бендичкова К., Тиду Ф., Зуани М.Д., Кохоуткова М.Х., Андрейчинова И., Помпеано А. и соавт. Ингибиторы кальциневрина снижают NFAT-зависимую экспрессию противогрибкового пентраксина-3 моноцитами человека. J Leukocyte Biol (2020) 107:497–508. doi: 10.1002/JLB.4VMA0318-138R

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

4. Самбандам Ю., Сундарам К., Сайгуса Т., Баласубраманян С., Редди С.В. Передача сигналов NFAM1 усиливает образование остеокластов и активность резорбции кости при костной болезни Педжета. Кость (2017) 101: 236–44. doi: 10.1016/j.bone.2017.05.013

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

5. Long J, Chen J, Wang Q, Gao F, Lian M, Zhang P, et al. Активирующий белок NFAT с мотивом ITAM 1 (NFAM1) активируется на циркулирующих моноцитах при ишемической болезни сердца и потенциально коррелирует с хемотаксисом моноцитов. Атеросклероз (2020) 307:39–51. doi: 10.1016/j.atherosclerosis.2020.06.001

PubMed Abstract | Полный текст перекрестной ссылки | Академия Google

6.Хаберман Ю., Карнс Р., Дексхаймер П.Дж., Ширмер М., Сомех Дж., Юрикова И. и др. Язвенный колит Транскриптомы слизистых оболочек выявляют митохондриопатию и персонализированные механизмы, лежащие в основе тяжести заболевания и ответа на лечение. Нац Коммуна (2019) 10:38. doi: 10.1038/s41467-018-07841-3

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

7. Pelia RS, Venkateswaran S, Matthews JD, Haberman Y, Cutler DJ, Hyams JS, et al. Профилирование уровней некодирующей РНК с помощью клинических классификаторов при детской болезни Крона.(2020). doi: 10.21203/rs.3.rs-88594/v1

CrossRef Полный текст | Google Scholar

8. Hultquist JF, Hiatt J, Schumann K, McGregor MJ, Roth TL, Haas P, et al. CRISPR-Cas9 Геномная инженерия первичных CD4+ Т-клеток для изучения взаимодействий факторов ВИЧ-хозяина. Nat Protoc (2019) 14:1–27. doi: 10.1038/s41596-018-0069-7

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

9. Ethiraj P, Haque IA, Alford AK, Gou W, Singh T, Sambandam Y, et al.Ингибирование NFAM1 подавляет передачу сигналов Phospho-SAPK/JNK во время дифференцировки остеокластов и резорбции кости. J Cell Biochem (2021). doi: 10.1002/jcb.30076

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

10. Guan Q. Всесторонний обзор и обновленная информация о патогенезе воспалительного заболевания кишечника. J Immunol Res (2019) 2019:1–16. doi: 10.1155/2019/7247238

CrossRef Полный текст | Google Scholar

15. LV W, Duan Q, Wang L, Gong Z, Yang F, Song Y.Экспрессия генов, ассоциированных с В-клетками, в мононуклеарных клетках периферической крови пациентов с симптоматической легочной эмболией. Mol Med Rep (2015) 11:2299–305. doi: 10.3892/mmr.2014.2978

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

16. Gourhant L, Bocher O, Martin LDS, Ludwig TE, Boland A, Deleuze JF, et al. Секвенирование всего экзома, безгипотетический подход к исследованию повторного невынашивания беременности на ранних сроках. Reprod BioMed Online (2021) 42:789–98.doi: 10.1016/j.rbmo.2021.01.008

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

17. Kurtas N, Arrigoni F, Errichiello E, Zucca C, Maghini C, D’Angelo MG, et al. Хромотрипсис и кольцевая хромосома 22: парадигма геномной сложности при синдроме Фелана-Макдермида (синдром делеции 22q13). J Med Genet (2018) 55:269. doi: 10.1136/jmedgenet-2017-105125

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

19. Luo C, Burgeon E, Carew JA, McCaffrey PG, Badalian TM, Lane WS, et al.Рекомбинантный NFAT1 (NFATp) регулируется кальциневрином в Т-клетках и опосредует транскрипцию нескольких генов цитокинов. Mol Cell Biol (1996) 16:3955–66. doi: 10.1128/mcb.16.7.3955

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

20. Zhu C, Rao K, Xiong H, Gagnidze K, Li F, Horvath C, et al. Активация промотора мышиного интерлейкина-12 P40 посредством функциональных взаимодействий между NFAT и ICSBP*. J Biol Chem (2003) 278:39372–82. doi: 10.1074/jbc.m306441200

PubMed Аннотация | Полный текст перекрестной ссылки | Google Scholar

21. Купраш Д.В., Бойтченко В.Е., Яровинский Ф.О., Райс Н.Р., Нордхайм А., Рюльманн А. и др. Циклоспорин А блокирует экспрессию лимфотоксина альфа, но не лимфотоксина бета, в мононуклеарных клетках периферической крови человека. Кровь (2002) 100:1721–7.

Реферат PubMed | Google Scholar

22. Катрин С., Пассаро Д., Гаше С., Медьюф Х., Рейно А., Ласги С. и другие. Факторы транскрипции NFAT являются важными и дублирующими действующими лицами для потенциала инициации лейкемии при остром Т-клеточном лимфобластном лейкозе. PloS One (2021) 16:e0254184. doi: 10.1371/journal.pone.0254184

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

23. Кавамура Т., Оно К., Моримото Т., Акао М., Иваи-Канаи Э., Вада Х. и др. Эндотелин-1-зависимый ядерный фактор передачи сигналов активированных Т-лимфоцитов ассоциирован с транскрипционным коактиватором Р300 в активации промотора В-клеточного лейкоза-2 в сердечных миоцитах. Circ Res J Am Hear Assoc (2004) 94:1492–9. doi: 10.1161/01.РЕЗ.0000129701.14494.52

Полнотекстовая перекрестная ссылка | Google Scholar

24. Mognol GP, Carneiro FRG, Robbs BK, Faget DV, Viola JPB. Клеточный цикл и регуляция апоптоза факторами транскрипции NFAT: новые роли старого игрока. Cell Death Dis (2016) 7:e2199–9. doi: 10.1038/cddis.2016.97

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

25. Гудридж Х.С., Симмонс Р.М., Андерхилл Д.М. Стимуляция дектина-1 дрожжами Candida Albicans или зимозаном запускает активацию NFAT в макрофагах и дендритных клетках. J Immunol (2007) 178:3107–15. doi: 10.4049/jimmunol.178.5.3107

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

26. Zanoni I, Ostuni R, Capuano G, Collini M, Caccia M, Ronchi AE, et al. CD14 регулирует жизненный цикл дендритных клеток после воздействия ЛПС посредством активации NFAT. Природа (2009) 460:264–8. doi: 10.1038/nature08118

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Транскрипционный анализ показывает сильную реакцию хозяина на Toxoplasma gondii во время ранней и поздней хронической инфекции у самцов и самок мышей

Исследования специфичности киллинга внутриклеточных патогенов макрофагами.
Р. Маклеод, Дж. С. Ремингтон.
Cell Immunol, 1 ноября 1977 г .; 34(1). PMID: 71951
Роль фактора регуляции эстрадиола — гидроксистероиддегидрогеназы (ГСД) в инфекции и патогенности Toxoplasma gondii.
Сяо Чжан, Цзин Лю, +4 автора, Музи Ли, Юн Фу, Таотао Чжан, Цянь Хань, Цюнь Лю. меньше
J Steroid Biochem Mol Biol, 10 сентября 2017 г .; 174. PMID: 28887145
Поведенческие аномалии у мышей, инфицированных токсоплазмой.
В. М. Хатчинсон, М. Брэдли, +2 автора, В. М. Чейн, Б. В. Уэллс, Дж. Хэй. меньше
Ann Trop Med Parasitol, 1 июня 1980 г .; 74(3). PMID: 7396566
Профилактика токсоплазматического энцефалита у лиц, инфицированных вирусом иммунодефицита человека.
Ф. О. Ричардс, Дж. А. Ковач, Б. Дж. Люфт.
Clin Infect Dis, 1 августа 1995 г .; 21 Приложение 1. PMID: 8547512
Обзор.
Влияние токсоплазмы на проявления вирусных инфекций Молони.
Р. Маклеод, Р. Г. Эстес, Х. Коэн.
Trans R Soc Trop Med Hyg, 1 января 1985 г .; 79(6). PMID: 2938310
Анализ данных ПЦР в реальном времени сравнительным методом C(T).
Томас Д. Шмиттген, Кеннет Дж. Ливак.
Nat Protoc, 13 июня 2008 г.; 3(6). PMID: 18546601
Часто цитируется.
Структурная и биохимическая характеристика циклофилинового семейства пептидил-пролилизомераз человека.
Тара Л. Дэвис, Джон Р. Уокер, +9 авторов, Валери Кампанья-Слейтер, Патрик Дж. Финерти, Рагика Параманатан, Галина Бернштейн, Фаррелл Маккензи, Вольфрам Темпель, Хуи Оуян, Вен Хва Ли, Элан З. Эйзенмессер, Сирано Дхе-Паганон. менее
PLoS Biol, 3 августа 2010 г.; 8(7). PMID: 20676357    Бесплатная статья PMC.
RSEM: точная количественная оценка транскриптов по данным RNA-Seq с эталонным геномом или без него.
Бо Ли, Колин Н Дьюи.
BMC Bioinformatics, 2011 Aug 06; 12. PMID: 21816040    Free PMC article.
Highly Cited.
MARCH-XI, a novel transmembrane ubiquitin ligase implicated in ubiquitin-dependent protein sorting in developing spermatids.
Yuri Morokuma, Nobuhiro Nakamura, +7 authors, Akira Kato, Michitaka Notoya, Yoko Yamamoto, Yasuhiro Sakai, Hidekazu Fukuda, Shohei Yamashina, Yukio Hirata, Shigehisa Hirose. less
J Biol Chem, 2007 Jul 03; 282(34).PMID: 17604280
Интерферон-гамма: основной медиатор резистентности к Toxoplasma gondii.
Ю. Судзуки, М. А. Орельяна, Р. Д. Шрайбер, Дж. С. Ремингтон.
Наука, 22 апреля 1988 г .; 240(4851). PMID: 3128869
Часто цитируется.
Влияние токсоплазмы на поведение человека.
Ярослав Флегр.
Schizoph Bull, 16 января 2007 г .; 33(3).PMID: 17218612    Бесплатная статья PMC.
Устойчивость к заражению вирусом у мышей, инфицированных простейшими или бактериями.
Дж. С. Ремингтон, Т. С. Мериган.
Proc Soc Exp Biol Med, 1 сентября 1969 г .; 131(4). PMID: 4309474
Опосредованная паразитами активация гамма-интерферона, полученного из NK-клеток, защищает от тяжелой высокопатогенной инфекции, вызванной вирусом гриппа H5N1.
Кевин Б. О’Брайен, Стейси Шульц-Черри, Лаура Дж. Нолл.
J Virol, 8 июля 2011 г.; 85 (17). PMID: 21734055    Бесплатная статья PMC.
Двойное профилирование транскрипции мышей и Toxoplasma gondii при острой и хронической инфекции.
Келли Дж. Питтман, Мэтью Т. Алиота, Лаура Дж. Нолл.
BMC Genomics, 23 сентября 2014 г.; 15. PMID: 25240600    Бесплатная статья PMC.
Высоко цитируемый.
Естественные киллеры, индуцированные острой и хронической токсоплазменной инфекцией.
В. Э. Хаузер, С. Д. Шарма, Дж. С. Ремингтон.
Cell Immunol, 15 мая 1982 г.; 69(2). PMID: 6980721
Пататин-подобный белок токсоплазмы меняет локализацию и изменяет цитокиновый ответ при токсоплазменном энцефалите.
Кристал Тобин Магл, Келли Дж. Питтман, +2 автора, Линдси А. Мозер, Кайл М. Болдон, Лаура Дж. Нолл. менее
Infect Immun, 31 января 2014 г.; 82(2). PMID: 24478077    Бесплатная статья PMC.
Иммунитет и внутриклеточная инфекция: устойчивость к бактериям у мышей, инфицированных простейшими.
Дж. Раскин, Дж. С. Ремингтон.
Наука, 5 апреля 1968 г .; 160(3823). PMID: 4966746
Gene Expression Omnibus: экспрессия генов NCBI и хранилище данных массива гибридизации.
Рон Эдгар, Михаил Домрачев, Алекс Э. Лэш.
Nucleic Acids Res, 26 декабря 2001 г .; 30(1). PMID: 11752295    Бесплатная статья PMC.
Высоко цитируемый.
Toxoplasma gondii: снижение устойчивости к инфекциям у мышей из-за эстрогена.
О Дж. Пунг, М. И. Блеск.
Exp Parasitol, 1 февраля 1986 г .; 61(1). PMID: 3943592
Активация TLR11 дендритных клеток профилиноподобным белком простейших.
Феликс Яровинский, Декай Чжан, +8 авторов, Джон Ф. Андерсен, Джерард Л. Банненберг, Чарльз Н. Серхан, Мэтью С. Хейден, Сара Хиени, Файяз С. Саттервала, Ричард А. Флавелл, Санкар Гош, Алан Шер. меньше
Наука, 30 апреля 2005 г .; 308 (5728). PMID: 15860593
Часто цитируется.
Роль гормонов в инфекции Toxoplasma gondii: систематический обзор.
Мария де ла Лус Гальван-Рамирес, Адриан Фернандо Гутьеррес-Мальдонадо, Фабиола Вердуско-Грихальва, Джудит Марсела Дуэньяс Хименес.
Front Microbiol, 28 октября 2014 г.; 5. PMID: 25346725    Бесплатная статья PMC.
Обзор.
Обоснование роли кератина 9 как биомаркера болезни Альцгеймера.
Джоанна Л. Риченс, Ханна Л. Спенсер, +5 авторов, Молли Батлер, Фиона Кэнтли, Келли-Энн Вер, Нин Баджадж, Кевин Морган, Пол О’Ши. меньше
научный представитель, 15 марта 2016 г.; 6. PMID: 26973255    Бесплатная статья PMC.
Половые гормоны и иммунитет к простейшим паразитам.
К. В. Робертс, В. Уокер, Дж. Александр.
Clin Microbiol Rev, 4 июля 2001 г.; 14(3). PMID: 11432809    Бесплатная статья PMC.
Обзор.
Устойчивость к Cryptococcus обеспечивается внутриклеточными бактериями и простейшими.
Л. О. Джентри, Дж. С. Ремингтон.
J Infect Dis, 1 января 1971 г .; 123(1). PMID: 5543220
Часто цитируется.
Приобретенная устойчивость к инфекции Schistosoma mansoni, индуцированной Toxoplasma gondii.
А.А. Махмуд, К.С. Уоррен, Г.Т. Стрикленд.
Природа, 2 сентября 1976 г.; 263 (5572). PMID: 958464
Идентификация уникальной TGF-β-зависимой молекулярной и функциональной сигнатуры в микроглии.
Олег Бутовский, Марк П. Джедрыховски, +15 авторов, Крейг С. Мур, Рон Сиалик, Аманда Дж. Лансер, Галина Габриэли, Томас Кеглспергер, Бен Дейк, Полин М. Ву, Камилла Э. Дойкан, Зейн Фанек, Липин Лю, Чжооксун Чен, Джеффри Д. Ротштейн, Ричард М. Рансохофф, Стивен П. Гиги, Джек П. Антел, Ховард Л. Вайнер. менее
Nat Neurosci, 10 декабря 2013 г.; 17(1). PMID: 24316888    Бесплатная статья PMC.
Высоко цитируемый.
Повышенный риск дорожно-транспортных происшествий у субъектов с латентным токсоплазмозом: ретроспективное исследование случай-контроль.
Ярослав Флегр, Ян Гавличек, +2 автора, Петр Кодым, Марек Малы, Збинек Смахел. меньше
BMC Infect Dis, 4 июля 2002 г .; 2. PMID: 12095427    Бесплатная статья PMC.
Профилин токсоплазмы необходим для инвазии клеток-хозяев и TLR11-зависимой индукции ответа интерлейкина-12.
Фабьен Платтнер, Феликс Яровинский, +4 автора, Стефан Ромеро, Доминик Дидри, Мари-Франс Карлье, Алан Шер, Доминик Солдати-Фавр.меньше
Cell Host Microbe, 4 марта 2008 г .; 3(2). PMID: 18312842
Часто цитируется.
Влияние половых гормонов на реакцию мышей на заражение Toxoplasma gondii.
Киттас, Л. Генри.
Br J Exp Pathol, 1 декабря 1980 г .; 61(6). PMID: 6257268    Бесплатная статья PMC.
Высокопроизводительное открытие новых фенотипов развития.
Мэри Э. Дикинсон, Энн М. Фленникен, +88 авторов, Сяо Цзи, Лидия Тебул, Майкл Д. Вонг, Жаклин К. Уайт, Терренс Ф. Михан, Вольфганг Дж. Венингер, Хенрик Вестерберг, Хибрет Адиссу, Кэндис Н. Бейкер, Линетт Бауэр, Джеймс М. Браун, Л. Брианна Кэддл, Франческо Кьяни, Дэйв Клэри, Джеймс Клик, Марк Дж. Дейли, Джеймс М. Денегре, Брендан Доу, Мэри Э. Долан, Сара М. Эди, Гельмут Фукс, Валери Гайлус-Дернер, Антонелла Галли, Алессия Гамбадоро, Хуан Гальегос , Шийинг Гуо, Нил Р. Хорнер, Чжи-Вэй Хсу, Сара Дж. Джонсон, Совмия Калага, Лэнс С. Кит, Луиза Лануэ, Томас Н. Лоусон, Монкол Лек, Мануэль Марк, Сьюзен Маршалл, Джереми Мейсон, Мелисса Л. МакЭлви, Сьюзен Ньюбиггинг, Лорил М.Дж. Наттер, Кевин А. Петерсон, Рамиро Рамирес-Солис, Дуглас Дж. Роуленд, Эдвард Райдер, Кейтлин Э. Самоча, Джон Р. Сивитт, Мохаммед Селлум, Зомбор Шоке-Ковач, Масару Тамура, Аманда Дж. Трейнор, Илинка Тудосе, Шигехару Вакана, Джонатан Уоррен, Оливия Вендлинг, Дэвид Б. Уэст, Лиян Вонг, Ацуши Йошики, International Mouse P консорциум генотипирования, лаборатория Джексона, национальная инфраструктура PHENOMIN, Institut Clinique de la Souris (ICS), Charles River Laboratories, MRC Harwell, Центр феногеномики Торонто, Wellcome Trust Sanger Institute, RIKEN BioResource Center, Daniel G MacArthur, Glauco P Tocchini-Valentini, Сян Гао, Пол Фличек, Аллан Брэдли, Уильям Си Скарнс, Моника Дж. Джастис, Хелен Э. Паркинсон, Марк Мур, Сара Уэллс, Роберт Э. Браун, Карен Л. Свенсон, Мартин Храбе де Анджелис, Ян Эро, Тим Мохун, Энн-Мари Мэллон , Р. Марк Хенкельман, Стив Д.М. Браун, Дэвид Дж. Адамс, К.С. Кент Ллойд, Колин МакКерли, Артур Л. Боде, Майя Бучан, Стивен А. Мюррей.менее
Nature, 15 сентября 2016 г.; 537 (7621). PMID: 27626380    Бесплатная статья PMC.
Высоко цитируемый.
Toxoplasma gondii активирует интерлейкин-12 для предотвращения экспериментальной церебральной малярии, вызванной Plasmodium berghei.
Эрик В. Сеттлз, Линдси А. Мозер, Таджи Х. Харрис, Лаура Дж. Нолл.
Infect Immun, 8 января 2014 г .; 82(3). PMID: 24396042    Бесплатная статья PMC.
Влияние врожденных и приобретенных во взрослом возрасте инфекций токсоплазмы на активность и реакцию мышей на новую стимуляцию.
Дж. Хэй, В. М. Хатчисон, П. П. Эйткен, Д. И. Грэм.
Ann Trop Med Parasitol, 1 октября 1983 г .; 77(5). PMID: 6660954
STAR: сверхбыстрый универсальный выравниватель RNA-seq.
Александр Добин, Кэрри А. Дэвис, +6 авторов, Феликс Шлезингер, Йорг Дренков, Крис Залески, Сонали Джа, Филипп Батут, Марк Чейссон, Томас Р. Гингерас. менее
Биоинформатика, 30 октября 2012 г.; 29(1). PMID: 23104886    Бесплатная статья PMC.
Высоко цитируемый.
Клонирование кДНК и характеристика сциеллина, белка домена LIM роговой оболочки кератиноцитов.
М. Ф. Шамплио, Р. Э. Берджесон, +2 автора, В. Джин, Х. П. Баден, П. Ф. Олсон. менее
J Biol Chem, 13 ноября 1998 г.; 273(47). PMID: 9813070
Совместное действие Toll-подобных рецепторов, чувствительных к нуклеиновым кислотам, и гетеродимеров TLR11/TLR12 придает мышам устойчивость к Toxoplasma gondii.
Уоррисон А. Андраде, Мария ду Карму Соуза, +7 авторов, Эспиридион Рамос-Мартинес, Камальприт Нагпал, Мириам С. Дутра, Мариан Б. Мело, Даниэлла С. Бартоломеу, Санкар Гош, Дуглас Т. Голенбок, Рикардо Т. Газзинелли. меньше
Cell Host Microbe, 8 января 2013 г .; 13(1). PMID: 232    Бесплатная статья PMC.
Высоко цитируемый.
Паттерны тканевой экспрессии идентифицируют гены ресничек мыши.
Тимоти С. МакКлинток, Чад Э. Глассер, Сома С. Боуз, Дэниел А. Бергман.
Physiol Genomics, 1 ноября 2007 г .; 32(2). PMID: 17971504
Мыши с нокаутом PSD-93 показывают, что нейрональные MAGUK не требуются для развития или функционирования синапсов параллельных волокон в мозжечке.
А. В. МакГи, Дж. Р. Топинка, +8 авторов, К. Хашимото, Р. С. Петралия, С. Какидзава, Ф. В. Кауэр, А. Агилера-Морено, Р. Дж. Вентхольд, М. Кано, Д. С. Бредт, Ф. Кауэр. менее
J Neurosci, 20 апреля 2001 г.; 21(9). PMID: 11312293    Бесплатная статья PMC.
Профилин Toxoplasma gondii способствует привлечению воспалительных моноцитов Ly6Chi CCR2+, которые могут придавать устойчивость к бактериальной инфекции.
Лори М. Нил, Лаура Дж. Нолл.
PLoS Pathog, 20 июня 2014 г.; 10(6). PMID: 24945711    Бесплатная статья PMC.
Нейроны являются первичной клеткой-мишенью для мозгового тропического внутриклеточного паразита Toxoplasma gondii.
Карла М. Кабрал, Шраддха Туладхар, +5 авторов, Ханс К. Дитрих, Элизабет Нгуен, Уэс Р. Макдональд, Тапасья Триведи, Аша Девинени, Анита А. Коши. меньше
PLoS Pathog, 20 февраля 2016 г.; 12(2). PMID: 26895155    Бесплатная статья PMC.
Высоко цитируемый.
Значение эндогенного интерферона-гамма для профилактики токсоплазматического энцефалита у мышей.
Ю. Сузуки, Ф. К. Конли, Дж. С. Ремингтон.
J Immunol, 15 сентября 1989 г.; 143(6).PMID: 2506275
Часто цитируется.
Поведенческие изменения, вызванные заражением грызунов токсоплазмой, очень специфичны для отвращения кошачьих запахов.
Аджай Вьяс, Сон-Кён Ким, +2 автора, Николас Джакомини, Джон К. Бутройд, Роберт М. Сапольски. меньше
Proc Natl Acad Sci U S A, 2007 Apr 04; 104(15). PMID: 17404235    Бесплатная статья PMC.
Высоко цитируемый.
Распознавание профилина Toll-подобным рецептором 12 имеет решающее значение для устойчивости хозяина к Toxoplasma gondii.
Алисия Коблански, Драгана Янкович, +7 авторов, Хёнджу О, Сара Хиени, Варадон Сунгнак, Рамкумар Матур, Мэтью С Хайден, Шизуо Акира, Алан Шер, Санкар Гош. менее
Иммунитет, 19 декабря 2012 г.; 38(1). PMID: 23246311    Бесплатная статья PMC.
Высоко цитируемый.
Определяемая полом резистентность к Toxoplasma gondii связана с временными различиями в продукции цитокинов.
CW Roberts, SM Cruickshank, J Alexander.
Infect Immun, 1 июля 1995 г.; 63(7). PMID: 77
    Бесплатная статья PMC.

Клуб Олега, Тарту (+372 5691 6136)

< >

Олег Голосий, В Матросском Клубе, 1991 | Ovcharenko

Oleg Стоковые видео и видео — 280 Стоковые видеоролики

Запуск бизнеса SaaS с нуля до 2 миллионов долларов в год – с Олегом Кэмпбеллом [176] | SaaS Club

Stream Hip-Hop & Twerking Club Mega Mix (Dj Oleg Titoff) by Oleg Titov 2 | Слушайте онлайн бесплатно на SoundCloud

Приглашенный спикер — 18 июля 2017 г. — Олег Каганович | Ротари Клуб Сакраменто

Стрим Олег Иск — Единая вечеринка (03-08-2019, Клуб РиверПорт, Киев) by Oleg Isk | Слушайте онлайн бесплатно на SoundCloud

Секретарь стиля: Олег Кассини и коллекция костюмов и текстиля Cornell | Коллекция Cornell Fashion + Textile

Российская Федерация.Санкт-Петербург. Газпром Арена. Футбол. Российская Премьер-лига 2020/2021. 12 тур РПЛ. «Зенит» — «Рубин». Player of..

7 OLEG CASSINI Canadian Club On The Rocks Старомодные очки для барных принадлежностей-Exc — $14,99 | PicClick

Олег Усманов рокабилли группа «Mister Twister» – Стоковое редакционное фото © alkir_dep #188227556 ​​

| Shazam

Cassette Club от Олега Масса на Amazon Music — Amazon.com

File:Oleg Siritsa, Lausanne Hockey Club — HC Sierre, 20.01.2010.jpg — Wikimedia Commons | Shutterstock

Королева ночного клуба Картина Олега Омельченко | Saatchi Art

Metropolitan Room Манхэттен, Нью-Йорк, музыка, джаз, джаз-клуб, джаз-клуб, джаз-клубы, Нью-Йорк, джаз, рок, Нью-Йорк, музыка, Манхэттен, Таймс-сквер, джаз-клуб, рок..

Российская Федерация. Санкт-Петербург. Газпром Арена. Футбол. Российская Премьер-лига 2020/2021. 12 тур РПЛ. «Зенит» — «Рубин». Игрок..

Олег Кувшинников: биография и карьера губернатора Вологодской области — знаменитости 2021

Канадский клуб Олег Кассини Очки Boxed Set 1973 | #1833

2

Олег Бубыренко Президент мини-футбольного клуба ЦСКА Фото со стока — Alamy

Amazon.com: 2019-20 Topps UEFA Champions League Match Attax #ZEN 10 Oleg Shatov ФУТБОЛЬНЫЙ КЛУБ ЗЕНИТ Официальная футбольная коллекционная карточная игра Playing ..

Продажи SaaS: как использовать консультационные продажи для развития вашего стартапа — с Олегом Рогинским [182] | SaaS Club

Реклама гольф-клуба — Олег Трушков Фото

TourBar — Travel Club: Олег, 47 лет, Киев, Украина

Свадебные платья в Surf Club on the Sound в Нью-Йорке

Вагнер — суперсила для любого клуба РПЛ, кроме Зенита, Репортаж Олега Яровинского — Футбол — World Today News

Файл: Олег Кассини и Джин Тирни в клубе «Аист».jpg — Wikimedia Commons

ArtStation — Ночной клуб, Олег Ловцов

The GAC Club Russia | Объединяем владельцев GS8

Limited Edition Dot Com (Vocal Club Mix; бонус-трек) — Oleg Di Vice & Andrews Feat. Мирра | Shazam

ArtStation — Клуб Nebula, Олег Даниленко

⭐️ Спортивный клуб рукопашного боя Олега Кабалинова в Паттайе. 🥋 Тренировки для воспитанников разного возраста и разного спортивного состояния. 😊 Г..

Набор из 10 значков ФК СССР Спорт Олег Блохин Значок игрока Игоря Беланова | eBay

Письма принцессы Грейс к Олегу Кассини Выставлены на аукцион 27 июня

Партнёрство Клуба Мальчиков и Девочек Армии Спасения — Triangle Ecycling

Олег Калугин в Русском клубе на лужайке Часть 2 — YouTube

Клуб Олега, Тарту

Олег Петров Приезд Нико — хороший выбор» — AS Monaco

Джазовые истории с Олегом Киреевым 23 февраля @ Клуб Студенческого культурного центра, Белград, Сербия.Удруга Культурна Инициатива

Элитный Клуб Олег, Красноярск — фото ресторана — Tripadvisor

Клуб изучения русского языка Подкаст — Олег Винжегин| подкастер | учитель русского | Listen Notes

Квартет Олега Максимова @ Esse Jazz Club — 20 мая 2021 г., 20:00

Олег Петров новый представитель профсоюза клубов в УЕФА

ДИЗАЙН ОДЕЖДЫ ОЛЕГ КАССИНИ ОРИГИНАЛЬНЫЙ АВТОГРАФ НА 8 x 10 Ч/Б ФОТО ТЕННИС КЛУБ | eBay

Spartak Club s Олег Романцев капитан сборной СССР по футболу Фото со стока — Alamy

Oleg Shatov » Клубные матчи » Лига Европы

Oleg Danchenko » Клубные матчи

1974 OLEG CASSINI ТЕННИСНЫЙ КЛУБ РЕТРО 70-х ОДЕЖДА Знак | eBay

Спортивный клуб «Миллениум» теперь принадлежит In-Shape Health Clubs – The Vacaville Reporter

2 Олег Кассини для Canadian Club Rocks Lowball Старомодные очки Gold Grid | eBay

Олег Кваша — Зеленоглазое Такси (Зеленоглазое Такси) (Club Remix) (HD) — YouTube

US Club Soccer ar Twitter: «Олег Вачев тоже с @SockersChicago и имеет лицензию @ussoccer_coach «A».Имеет тренерский опыт.

VTG 8 OLEG CASSINI для CANADIAN CLUB Двойные очки Old Fashioned NEW OLD STOCK | eBay

ArtStation — Ночной клуб, Олег Ловцов | Night club, Night, Club

Россиянин Олег Петров официально назначен управляющим директором AS Monaco | Frontline Club

В настоящее время у вас недостаточно прав для чтения этого закона

В настоящее время у вас недостаточно прав для чтения этого закона Логотип паблика.Логотип Resource.Org представляет собой черно-белый рисунок улыбающегося тюленя с усами. Вокруг печати красная круглая полоса с белым шрифтом, на которой в верхней половине написано «The Creat Seal of the Seal of Approval», а в нижней половине «Public.Resource.Org». На внешней стороне красной круглой марки находится круглая серебряная круглая полоса с зубчатыми краями, напоминающая печать из серебряной фольги.

Public.Resource.Org

Хилдсбург, Калифорния, 95448
США

Этот документ в настоящее время недоступен для вас!

Дорогой земляк:

В настоящее время вам временно отказано в доступе к этому документу.

Public Resource судится за ваше право читать и высказываться в соответствии с законом. Для получения более подробной информации см. досье этого незавершенного судебного дела:

.

Американское общество испытаний и материалов (ASTM), Национальная ассоциация противопожарной защиты (NFPA), и Американское общество инженеров по отоплению, охлаждению и кондиционированию воздуха (ASHRAE) против Public.Resource.Org (Общественный ресурс), DCD 1:13-cv-01215, Объединенный окружной суд округа Колумбия [1]

Ваш доступ к этому документу, который является законом Соединенных Штатов Америки, был временно отключен, пока мы боремся за ваше право читать и говорить о законах, по которым мы хотим управлять собой как демократическим обществом.

Чтобы подать заявку на получение лицензии на чтение этого закона, ознакомьтесь со Сводом федеральных правил или применимыми законами и правилами штата. для имени и адреса поставщика. Для получения дополнительной информации о указах правительства и ваших правах гражданина в соответствии с законом , пожалуйста, прочтите мое свидетельство перед Конгрессом Соединенных Штатов. Более подробную информацию о нашей деятельности вы можете найти на сайте Public Resource. в нашем реестре деятельности 2015 года. [2][3]

Благодарим вас за интерес к чтению закона.Информированные граждане являются фундаментальным требованием для того, чтобы наша демократия работала. Я ценю ваши усилия и приношу извинения за неудобства.

С уважением,

Карл Маламуд
Public.Resource.Org
7 ноября 2015 г.

Примечания

[1]   http://www.archive.org/download/gov.uscourts.dcd.161410/gov.uscourts.dcd.161410.docket.html

[2]   https://public.resource.org/edicts/

[3]   https://public.resource.org/pro.docket.2015.html

биография, личная жизнь и интересные факты. Биография слуцкого тренера что

Тренер Леонид Слуцкий в футболе фигура весомая и авторитетная. Как спортивного наставника его не критиковал только ленивый. Сам он утверждает, что давно привык к нападкам и насмешкам, которым подвергался за профессиональные шаги и даже внешний вид (из-за чрезмерного веса Леонида прозвали Бегемотом).

На поле и в раздевалке Слуцкий исходил из того, что ни тренер, ни его партнёры по команде не представляют для игрока интереса.Для футболиста на первом месте была, есть и будет собственная карьера, личный успех. Задача тренера – выявить сильные стороны спортсмена, повысить его результативность и максимально эффективно вписаться в схемы игры.

Детство и юность

Леонид Викторович родился в Волгоградском родильном доме 4 мая 1971 года. Родители были рады сыну, но вскоре случилась трагедия. Когда Лене было 6 лет, ушел из жизни отец, мастер спорта по боксу.Ряд источников приписывают главе семьи Виктору Борисовичу еврейские корни, но доказательств этому не приводят. Вопрос о национальности тренера возник, когда Слуцкий был в компании и снялся в рекламе еврейского культурного центра.


Мальчик рос с мамой, которая работала воспитателем детского сада, а потом стала заведующей этим дошкольным учреждением. Леня рос отзывчивым и добрым ребенком. Он, как и все дети Советского Союза, ходил в школу, а с 3-го класса был зачислен в футбольную секцию стадиона «Спартак».

После получения аттестата об окончании средней школы Леонид Слуцкий продолжил образование в Волгоградском государственном институте физической культуры. Одновременно с учебой в высшем учебном заведении Леонид стал игроком-вратарем молодежной футбольной команды «Звезда» из Городища.


В юности спортсмен подавал надежды, но все закончилось в один осенний день. Отзывчивость и доброта сыграли с Леонидом злую шутку. Решив помочь соседу достать из тополя домашнюю кошку, Слуцкий поставил крест на карьере игрока.Ветви дерева не выдержал юный футболист, и вместо тренировки он оказался на больничной койке с переломами и сотрясением мозга. Лечение длилось целый год. Леонид Слуцкий смог разработать коленный сустав, но карьера вратаря закончилась.

Тренерская карьера

Леонид Викторович Слуцкий был отличником, с отличием окончил институт физкультуры. После этого продолжил образование в аспирантуре, параллельно начав тренерскую деятельность.Ему было 22 года, когда он завербовал в свою команду «Олимпия» 12-летних мальчишек, мечтавших стать известными футболистами. Под руководством Слуцкого волгоградская «Олимпия» к 1999 году выиграла Кубок России, получив шанс выступать во втором дивизионе.


Леонид Слуцкий и команда «Олимпия»

С 2001 года Леонид начал тренировать футболистов, играющих в резервном составе «Уралана» из Элисты. После распада элистинского клуба Леонид Викторович занял тренерскую должность во втором составе московского футбольного клуба.Ему не пришлось долго тренировать двойника. Уже в 2005 году мужчина стал наставником основной команды.

Такое сотрудничество с московским клубом продлилось 2 года, хотя игроки смогли получить приз в Кубке России. На тот момент ФК «Москва» остался на 4-м месте и получил возможность сыграть в Кубке УЕФА.


Леонид Слуцкий на тренировке ФК «Москва»

Несмотря на все достижения команды, Леонид Викторович Слуцкий был уволен со своего поста, досрочно разорвав контракт, который был подписан до 2010 года.

Мужчина не остался без работы, ему предложили стать главным тренером самарских «Крыльев Советов». Контракт был подписан на 3 года, но и тогда были трения и непонимание. Хотя клуб играл с хорошей результативностью, Леониду Викторовичу все же пришлось уйти через 2 года, написав заявление об увольнении по собственному желанию.


Леонид Слуцкий — главный тренер клуба «Крылья Советов»

С 2009 года — тренер профессионального клуба ЦСКА.Под его руководством спортсмены вышли в плей-офф Лиги чемпионов, а в 2011 году выиграли чемпионат, взяв в 6-й раз Кубок России. Эта награда стала первым трофеем для тренера Слуцкого.

Сейчас мало кто помнит, что против назначения главой тренерского штаба армейцев выступил болельщик по имени Маликов, возомнивший себя привилегированным болельщиком только потому, что однажды перевел 3 миллиона рублей на детскую школу. Этот человек пришел к руководству клуба и сказал, что в случае хоть какой-то победы ЦСКА во главе со Слуцким купит бегемота для Московского зоопарка и в дальнейшем будет о нем заботиться.Как только команда завоевала титул, болельщик исчез, «умело соскочил».


В августе 2015 года Слуцкому доверили тренировать игроков сборной России, оставив при этом возможность тренировать ЦСКА Москва. После провала на Евро-2016 Леонид Слуцкий заявил о желании покинуть пост главного тренера сборной России.

В интервью одному спортивному изданию наставник чемпиона рассказал, что к середине 2000-х у него изменилось отношение к подопечным.К своей спортивной биографии Слуцкий вывел 2 тренерских постулата – управление людьми и собственно футбол.


«Я не пытаюсь просвещать или ставить эфемерные цели, не вникаю в гуманитарный аспект. Все довольно просто – я должен стремиться к дисциплине, выполнению своих требований. По сравнению с собой 10 лет назад я стал более циничным тренером, более требовательным, лишний раз не объясняющим свои решения. Меня гораздо больше интересует, что у игроков друг с другом, чем то, как они относятся ко мне.

В 2017 году Леонид Викторович перебрался на Туманный Альбион и принял британский клуб «Халл Сити». Российскому тренеру пришлось выучить английский язык, но, видимо, не очень хорошо, так как в разговоре с голландскими журналистами он перепутал слова сак и отсос.


Если первое перевести как безобидное «уволить», то второе прозвучало в этом контексте нецензурно.При этом оговорка Слуцкого вызвала ажиотаж только в российских СМИ, окружение Леонида вообще не понимало о чем речь о.

Английский период в карьере запомнился тренеру тем, что ему приходилось работать с командой, из которой почти каждый день уходили игроки. По сути, предсезонку Слуцкий провел с одним составом, чемпионат страны начался со вторым, а к 5-му туру сформировался третий. Надежды тренеров и владельцев на результативность не оправдались: Леонид покинул клуб, когда занял 20-е место из 24-х в Чемпионате. Контракт был расторгнут по обоюдному согласию.


Слуцкий приехал в Нидерланды в середине 2018 года, чтобы тренировать местный «Витесс».В Англии тренера поддержал бизнесмен, на новом месте работы — владелец команды, нефтяной магнат и девелопер Шалва Чигиринский, выкупивший клуб у хорошо известного любителям футбола советских времен Мераба Жордания. . По слухам, истинным владельцем «Витесса» был как раз Абрамович.

Телевидение

Жизнь Леонида Викторовича не однообразна. Его интересует не только спорт. Его увлечения связаны с Клубом веселых и находчивых и телевизионным комедийным шоу «Хорошие шутки».

Леонид Слуцкий в КВН

Мужчина выступал за волгоградскую команду «Третьи сыновья», принимал участие в играх Высшей лиги КВН, выступая не только тренером, но и танцором, и музыкантом. Леонид Слуцкий не представляет своей жизни без спорта и без юмора.

В 2017 году тренер дебютировал в качестве спортивного комментатора, когда вел четвертый матч финала Лиги чемпионов с Нобелем Арустамяном.

Личная жизнь

Личная жизнь Леонида Слуцкого сложилась в 32 года, когда он женился на Ирине.Жена по образованию философ и, наверное, поэтому с пониманием относилась к постоянному отсутствию мужа. В редкие приезды мужа Ира обеспечивала ему полноценный отдых, как писали СМИ, Леонид ничего не делал дома руками.


Сын Дмитрий, 2005 года рождения, не разделяет увлечения отца спортом. Парень, по словам его бабушки, мечтал стать ученым, чтобы придумать лекарство от рака, от которого умер его дед.Вырос — увлекся рэпом.

В 2014 году на фотографиях, опубликованных в прессе, Слуцкий предстал значительно похудевшим. Он рассказал, что с помощью белково-овощной диеты и плавания похудел на 13 кг. Правда, на какой отметке остановилась стрелка баланса, мужчина, рост которого 181 см, не уточнил.

Леонид Слуцкий сейчас

Контракт Леонида Слуцкого с «Витессом» рассчитан до конца 2020 года. На момент прихода нового тренера команда находилась на 6 месте в чемпионате страны.Руководство клуба привлекло в российском специалисте тактическую смекалку, индивидуальный стиль и внимание к деталям в «взрослении» футболистов.


Леонид Слуцкий в Нидерландах

В Арнеме, где базируется «Витесс», Леонид познакомился с бывшим игроком ЦСКА Вячеславом Караваевым. На первую тренировку первого российского тренера в голландском футболе собралось 7 тысяч зрителей. Случайно или нет, но осенью 2018 года клуб начал продавать шапки-ушанки со своей символикой.Слуцкий начал с нововведений: сделал свободное посещение приемов пищи, стал проводить по 2 тренировки в день, хотя футболисты опасались, что не выдержат, с игр за пределами страны спортсменам разрешалось возвращаться сразу домой, а не в база.

Масштабы голландской команды, конечно, не идут ни в какое сравнение с армейской. По данным сайта ransfermarkt.de, общая стоимость игроков основы «Витесса» составила €27,3 млн, а состав ЦСКА оценивался в €101.68 миллионов. Даже «Халл Сити» стоил больше — €65,3 млн.


Тренер голландской команды «Витесс» Леонид Слуцкий

Леонид Викторович отметил высокий уровень национального первенства и выразил надежду, что игроки поборются за 3-е место в турнирной таблице. К перерыву в сезоне 2018-2019 «жёлто-чёрные» ушли с 5-й позиции.

Слуцкий мечтает остаться в Нидерландах на 10 лет. Тренер покинул особняк и живет в скромной квартире, соседи — пенсионеры, а семья осталась в Москве.Служебный автомобиль выделил спонсор – автомобильный концерн «Ауди». Попытки выучить язык прекратились через пару занятий: «Английского достаточно, чтобы донести все свои мысли до игроков, коллег по штабу, руководству, болельщикам». Леонид особенно доволен возможностью везде ездить на велосипеде.


В первые дни 2019 года к Леониду Викторовичу в роли ассистентов ориентировочно до конца сезона присоединились завершившие карьеру игроки ЦСКА и сборной России.Кроме того, тренер намерен усилить состав «Витесса» спартаковцем Джано Ананнидзе, о выступлении которого в чемпионате России Слуцкий хорошо знает.

Леонид Слуцкий согласовал контракт с голландским «Витессом», клубом высшего дивизиона чемпионата Нидерландов – Эредивизи.

Российский тренер должен возглавить команду со старта сезона 2018/19. Соглашение рассчитано на два года.

Слуцкий станет первым россиянином, возглавившим голландский клуб.Также «Витесс» подписал контракт с помощником Слуцкого Олегом Яровинским.

Ранее специалист работал с другой европейской командой — «Халл Сити» с чемпионата Англии, но в декабре 2017 года был уволен из стана «Тигр» за неудовлетворительные результаты.

Технический директор «Витесса» Марк ван Хинтум отметил, что у российского специалиста есть все необходимые качества для работы главным тренером.

На данный момент команду возглавляет голландец Хэнк Фрейзер, с которым она впервые выиграла Кубок страны.Ожидается, что Фрейзер перейдет в другой клуб после текущего сезона. По данным De Telegraaf, специалист не ладил с руководством, которое слишком явно вмешивалось в его работу. По той же причине Му Аллах ранее покинул клуб.

Остается только надеяться, что Слуцкий найдет общий язык с первыми лицами «Витесса», учитывая, что владелец клуба — российский бизнесмен, а в наблюдательном совете — россиянин.

С января 2018 года команду играет российский защитник, который в сезоне 2013/14 провел два матча за ЦСКА под руководством Слуцкого.

Отечественный специалист с августа 2015 по июль 2016 года возглавлял сборную России. Он вывел команду в финальную стадию Евро-2016, где сборной не удалось выйти в плей-офф. С октября 2009 года по декабрь 2016 года Слуцкий был главным тренером ЦСКА, трижды выиграв чемпионат России, дважды Кубок и Суперкубок России. В сезоне 2009/10 московский клуб дошел до четвертьфинала Лиги чемпионов.

В июне 2017 года Слуцкий возглавил «Халл», став первым русским тренером в Англии.

В декабре того же года стороны расторгли договор по обоюдному согласию. Яровинский покинул клуб вместе с главным тренером. К тому времени Халл занимал 20-е место (из 24) в турнирной таблице чемпионата с 19 очками.

«Леонид работал не покладая рук, работал честно и с удовольствием. К сожалению, результаты команды не улучшились, не оправдав ожиданий обеих сторон. Это и стало причиной прекращения сотрудничества. Хочу поблагодарить Леонида за работу и пожелать им успехов», — прокомментировал увольнение Слуцкого с поста главного тренера команды владелец клуба Асем Аллам.

На данный момент технический директор «Витесса» Ван Хинтум и другие специалисты считают, что приезд экс-рулевого сборной России — хорошая возможность для команды улучшить результаты. Ван Хинтум, среди прочего, заявил, что во время переговоров у клуба не было проблем со Слуцким.

«Слуцкий — открытый человек с ясными взглядами. Он харизматичен и отлично говорит по-английски. Так что проблем у нас не было.

Здорово, что мы наняли человека с большим международным опытом, который многому научился.Он бесплатно тренировал сборную и добился больших успехов с ЦСКА. Да, у нас будет что-то другое здесь. Что-то новое, но я получил несколько положительных отзывов об этом. Он станет первым россиянином в высшем голландском дивизионе», — цитирует директора Омроэпа Гелдерланда.

Ван Хинтум также рассказал, как проходило согласование кандидатуры Слуцкого. По словам технического директора, пригласить его удалось благодаря связям, которые есть у клуба, так как иначе российский тренер не принял бы приглашение от «Витесса».

«В наблюдательный совет выдвинута кандидатура Слуцкого. Мне кажется, что без наших связей его было бы сложно пригласить, он тренер с таким именем.

Я не говорю о деньгах, так как уверен, что у тренера были и другие предложения. Он мог найти работу где угодно, но выбрал Витесс, — сказал Ван Хинтум.

Тренер голландцев Роберт Маскант, в свою очередь, не менее положительно оценил назначение российского специалиста на пост наставника «Витесса».

«Я сторонник того, чтобы в Голландии были свои тренеры, но в чемпионате они руководствуются качествами специалиста.

Слуцкий — хороший тренер, он добился успехов в России. Не удивлюсь, если в «Витессе» в ближайшее время появятся восемь-девять россиян», —

.

— рассказал Мускант vi.nl, после чего любопытно прокомментировал появление российского тренера. — Слуцкий всегда выглядит пьяным, но, насколько мне известно, он вообще не употребляет алкоголь. Это необычно для россиянина.

Витесс играет в высшем дивизионе чемпионата Нидерландов. По итогам 27 туров клуб с 41 очком занимает шестое место в турнирной таблице, отставая от лидирующего ПСВ на 27 очков. В текущем сезоне чемпионата команде осталось сыграть семь игр.

Россиянин получил второй шанс в Европе после вылета своего Халла. Как минимум – можно гордиться тем, что Слуцкий стал первым российским тренером, возглавившим голландский клуб, и совершенно не боится работать в Европе.

Другие новости, материалы и статистику можно посмотреть на странице, а также в группах спортивного отдела в социальных сетях

Будет рассчитан на два года и вступит в силу со следующего сезона. А пока команду будет тренировать Фрэнк Фрейзер , под руководством которого она сейчас занимает шестое место в чемпионате Нидерландов. контракт Фрейзер с клубом «Арнем» рассчитан до конца этого сезона, поэтому его уход не обременит «Витесс» какими-либо обязательствами.

Ассистент Слуцкий в его новой команде будут те, с кем он работал в, и в, и в, и в.

Впервые о том, что Слуцкий может возглавить «Витесс», голландские СМИ заговорили в конце ноября — начале декабря 2016 года, после того как стало известно, что тренер покинет ЦСКА. Однако специалист уехал в Англию, где принял «Халл», который покинул в декабре 2017-го. 28 января этого года Слуцкий был замечен на матче Кубка Англии — сидящим на трибуне рядом с лидерами «Витесса» — генералом директор Йостом де Вит и технический директор Марк ван Хинтум .

ЧТО ГОВОРЯТ В ВИТЕСС

Ван Хинтум Сегодня он был щедр на комплименты в адрес 46-летнего российского тренера.

«Леонид известен своей тактической смекалкой, вниманием к деталям и четким пониманием того, каким должен быть стиль игры. Его приход — возможность для «Витесса» выйти на новый уровень. Рад, что человек с такими качествами будет работать в нашем клубе. У него богатый международный опыт — в частности, он был главным тренером сборной», — сообщил ван Хинтум официальному сайту «Витеса».

«Эти качества были для нас приоритетными в наших поисках, они гораздо важнее национальности», — подчеркнул он.

КТО УПРАВЛЯЕТ КЛУБОМ АРНЕМ

Владелец «Витеса» — российский бизнесмен Александр Чигиринский , входивший в 2000-е годы в топ-100 богатейших людей РФ. Он приобрел клуб в 2013 году у бывшего советского футболиста Мераба Жордания .

По данным голландских СМИ, к руководству «Витессом» причастен хороший друг Слуцкого.В 2010 году, когда Жордания перешел в «Витесс», появилась информация, что истинным владельцем клуба является Абрамович. Грузин этого не подтверждал, но при этом не скрывал своей дружбы с владельцем «Челси». Неофициальное сотрудничество между арнемскими и лондонскими командами действительно существует — более 20 «синих» посетили «Витесс» в аренде, например, серб, который сейчас играет за «Манчестер Юнайтед».

ЧТО ДОСТИГ ВИТЕСС

Желто-черные постоянно находятся в высшем дивизионе Нидерландов с 1990 года.Однако выше третьего места они не поднялись. Если говорить о последних трех чемпионатах, то в сезоне 2014/15 «Витесс» занимал пятое место, в сезоне 2015/16 — девятое, а в сезоне 2016/17, в котором взял Кубок страны, — опять пятый. В нынешнем чемпионате, как было сказано выше, арнемцы занимают шестую строчку.

По данным transfermarkt.de, общая стоимость игроков основы «Витесс» составляет 27,3 млн евро. Для сравнения: состав ЦСКА, где долгое время работал Слуцкий, оценивается в 101.68 млн, а «Халла» — 65,3 млн.

В «Витессе» есть и российский футболист — защитник, хорошо знакомый Слуцкому по ЦСКА. За голландскую команду экс-солдат на данный момент сыграл четыре матча. Недавно в «Витессе» был еще один российский игрок — форвард, вернувшийся в «Локомотив» летом 2017 года.

Русский «пельмень», нелепо качающийся туда-сюда на скамейке запасных, но в то же время жесткий и волевой тренер-чемпион, заставивший смотреть и уважать российский футбол.Внешне немного неуклюж, но в жизни он настоящий импровизатор, подвижный и артистичный, с прекрасным чувством юмора. Петь, танцевать — не вопрос. И все это он — Леонид Викторович Слуцкий.

Биография

Все фотографии 10

Леонид Слуцкий был оставлен без отца рано. Виктор Борисович, мастер спорта по боксу, умер, когда мальчику было шесть лет.Все заботы по воспитанию маленького Лени легли на плечи его мамы, заведующей детским садом. Никто не знал, что ночью она мыла полы, чтобы погасить кредит за квартиру.

Наталья Николаевна мечтала, чтобы ее сын вырос юристом или журналистом, но у мальчика с детства была одна страсть — футбол.

С девяти лет Леонид начал посещать футбольную школу, при этом прекрасно совмещал учебу и тренировки и окончил школу с золотой медалью.Будучи студентом Волгоградского института физической культуры, он уже защищал ворота команды «Звезда». Леонид окончил институт с отличием. Окончил аспирантуру, сдав все кандидатские минимумы на отлично. В 2009 году защитил кандидатскую диссертацию.

Слуцкий и сам мог бы стать хорошим футболистом, но его судьбу предопределил соседский кот. Именно ее подающий надежды вратарь полез спасать дерево и упал, получив многооскольчатый перелом левой ноги.Врачи говорили даже об инвалидности. К счастью, этого не произошло, но профессиональная карьера парня завершена.

Так бывший вратарь в 22 года стал тренером волгоградской детской команды «Олимпия», которую собрал с нуля. Я сама писала объявления от руки дома, а мама ходила и расклеивала их по району. Спустя несколько лет судьба щедро наградила Слуцкого за его настойчивость. Двое его воспитанников – Роман Адамов и Денис Колодин – попали в сборную на Евро-2008, где наши футболисты завоевали столь заветную «бронзу».Роман в знак благодарности своему наставнику купил ему квартиру в Волгограде, чем растрогал маму тренера до слез. Ведь, по словам самого Слуцкого, именно она долгие годы окружала юных подопечных сына материнской заботой. Олимпия была его гордостью, его детищем. Слуцкий неоднократно признавался, что не был счастливее, чем тогда.

Главные тренерские трофеи Леонида Слуцкого связаны с ЦСКА. За семь лет работы (Слуцкий тренировал армейцев с 2009 по 2016 год) трижды выигрывал чемпионат России (2013, 2014, 2016), дважды Кубок России (2011, 2013) и Суперкубок России (2013, 2014). .Леонид Викторович трижды признавался лучшим тренером РФС. Слуцкий всегда предпочитал агрессивный атакующий футбол, боролся за инициативу на протяжении всего матча, даже если речь шла о топ-клубах мира. Обыграть испанцев и выйти в четвертьфинал Лиги чемпионов — исторический момент в национальном футболе.

Слуцкого называют «русским Моуриньо». Португалец тоже не стал профессиональным игроком, но многие специалисты и игроки считают его величайшим тренером современности.Острые на язык поклонники прозвали Слуцкого «Пельменем» за его плотное телосложение, но он не обижается и сам не прочь поиздеваться над своей комплекцией.

2016 год был очень сложным для Леонида Викторовича: провал сборной России на чемпионате Европы и уход с поста главного тренера, добровольный уход из ЦСКА и несостоявшийся английский вояж в «Халл Сити». Но он и не думает переставать пробовать новые роли. Так в 2017 году Слуцкий дебютировал в качестве комментатора и получил восторженные отзывы коллег.Настолько виртуозно, грамотно и точно он анализирует интересные моменты матча, что с его помощью вы сможете выучить азбуку футбола прямо у экрана.

Теперь Слуцкий помогает не только спортсменам, но и… юмористам. Его КВН известен давно.

Слуцкий всегда желанный гость на Первом канале. Он уверенно держится в кадре, импровизирует на ходу, с иронией говорит о наболевшем. Он дважды был героем шоу «Вечерний Ургант», где беззастенчиво высмеивал себя и российский футбол.«Если Англия — родина футбола, то у нас родина альтернативного футбола», «Для них тренер — вершина, босс, для наших игроков — физрук, с которым можно курить» — его шутки сделали ведущий и публика смеются без перерыва.

Слуцкий играл в «Что? Где? Когда? », не боясь показаться глупее завсегдатаев интеллектуального клуба. Его команда обыграла зрителей со счетом 6:4.

Леонид Слуцкий не собирается уходить на пенсию.Летом 2018 года его карьера продолжится в голландском «Витессе». На чувства болельщиков Леонид Викторович с присущим ему оптимизмом и юмором ответил: «Какие проблемы могут быть у человека, который уезжает в Голландию? И если они есть, я знаю, как их решить!

Личная жизнь

Личное счастье Леонид нашел в достаточно зрелом возрасте, ему было 32 года. Судьбоносная встреча произошла в Ростове. Он ехал на машине, она голосовала на дороге. лифт, обменялись телефонами.И вскоре они поженились. Ирина Слуцкая, философ по образованию, человек абсолютно непубличный. Она сразу приняла весь образ жизни мужа и никогда не «придиралась» к нему за невнимательность, она понимает, насколько он занят работой.

В 2005 году у пары родился сын Дмитрий. Детство без отца не помешало Слуцкому стать настоящим мужчиной и отличным семьянином. Он обожает своего сына, балует его. Только Диме позволено звонить папе после поражений. Правда, сам мальчик мало интересуется футболом, и, работая в чемпионате России, Слуцкий приглашал на матчи не сына, а крестницу.Дима сначала хотел стать космонавтом, потом военным, потом бизнесменом. И теперь он мечтает стать ученым и открыть таблетки, которые помогут от СПИДа и рака. «Хороший сон», — говорит отец.

Удивительно, но, дав наследнику имя Дмитрий, Леонид Викторович даже не подозревал, что в семье уже есть один Дмитрий Слуцкий. Его сводный брат от первого брака отца давно живет с семьей в Германии. В 2010 году он подал о себе новость в соцсети и теперь братья регулярно общаются и летают друг к другу в гости.А вот с Ириной Слуцкой, нашей знаменитой фигуристкой, у Леонида Викторовича родственных связей нет, они просто однофамильцы.

Ему есть что рассказать тем, кто только начинает постигать азы своей профессии — студентам. «АиФ» посетил МГУ и прослушал «тренерские наставления» Слуцкого для молодежи.

О забавных планах и футбольной дружбе

Есть известная фраза: если хочешь рассмешить Бога, расскажи ему о своих планах.Но если говорить о профессии тренера, то это в три раза смешнее. В одно мгновение можно превратиться в кого угодно, пойти как вверх, так и вниз. Тренер всегда заложник ситуации. Позвольте привести пример. Помните, в том году в Лиге чемпионов было противостояние «Барселоны» и «ПСЖ». В первом матче – крупная победа ПСЖ (4:0), в ответном матче ПСЖ пропустил большое количество голов за 6 минут до конца встречи (поражение 1:6). Я посмотрел на тренера ПСЖ Эмери. Это был тот же Эмери, что и вчера — тот же уровень мастерства, амбиций, способностей. Но изменился счет — изменилось и отношение к этому человеку, который просто стоял в технической зоне и не имел возможности контролировать игру, все изменения он уже сделал. 6 минут перевернули все с ног на голову: вот он — герой, купающийся в славе, который обыгрывает «Барселону» и может выиграть Лигу чемпионов, а вот он — изгой, которого все ненавидят… Поэтому я никогда не думаю о завтрашнем дне, следующий шаг, долгая карьера.Я просто стараюсь отдавать максимальное количество энергии тому месту, где работаю сегодня.

Главная цель тренера – результат. Какая атмосфера будет в команде, иногда не так важно. Есть отличные команды, где игроки даже не здоровались друг с другом, что не мешало им добиваться побед. Когда дело доходит до действительно профессиональных людей, их все равно убьют в полевых условиях. Может быть, не столько для товарищей по команде, сколько для себя.

Чем выше уровень амбиций команды, тем сложнее управлять командой вне профессиональной деятельности.Так вот, за 7 лет работы в ЦСКА мы ни разу не встречались в полном составе – будь то свадьба, день рождения или даже банкет к чемпионату. Аналогичная ситуация в Англии. В работе все отлично, нареканий нет. А вот собираться вне работы… Хотя не уверен, что это нужно. Не надо объединять разрозненное, заставлять дружить людей разных поколений, разных стран, разных религий. Им просто предстоит решать совместные задачи на поле.Моя задача как тренера — создать микроклимат, в котором футболисты могли бы реализовать себя, вырасти, не бояться совершать какие-либо действия, понимая, что они имеют право на ошибку.






Об Англии и новой работе

Англия – родина футбола, и все, что с ним связано, там фактически является религией. Причем, если на религиозную тему англичане умеют цинично шутить, то на тему футбола я таких шуток еще не слышал.

Однажды мы решили поиграть с обслуживающим персоналом Халл Сити, и обнаружилась удивительная вещь: врачи, физиотерапевты, представители медиаслужбы — все они умеют играть в футбол. Это обязательный предмет в школе, и каждый английский мальчик мечтает стать футболистом. А те, у кого не получилось, с большим уважением относятся к тем, у кого получилось, у кого было больше способностей, желания, трудолюбия и т. д., то есть к тем, кто профессионально занимается футболом — игрокам, тренерам.Именно поэтому они даже ездят болеть за команды четвертого дивизиона. И я очень надеюсь, что мы к этому придем.

Исторически у Витесса и Челси сложились определенные отношения. (Слуцкий начнет работать в «Витессе» летом 2018 года; при этом тренер неоднократно подчеркивал, что в последнее время ему помогал владелец «Челси» Роман Абрамович . — Ред.) Но «Витесс» — независимый клуб, у которого есть своя собственный владелец (в 2013 году акции голландского клуба купил бизнесмен Чигиринский — старый друг Абрамовича.- Ред.). Да, в нынешнем «Витессе» в стартовом составе 3 игрока в аренде у «Челси». Однако у «Челси» в аренде более 40 игроков как в Англии, так и в других европейских лигах. Потому что эти игроки просто не могут попасть в основной состав. Это лишь говорит о том, что «Челси» — это огромная футбольная машина, которая продуктивно работает. Не думаю, что Роман Аркадьевич позвонит мне и будет настаивать на том, чтобы «Витесс» взял какого-то игрока.

О собственной школе и потерянных талантах

Больше года назад я открыл в Волгограде футбольную школу, которую полностью финансирую за свой счет.250 мальчишек имеют прекрасные условия для занятий футболом, работают квалифицированные тренеры. Кстати, все они мои воспитанники волгоградской Олимпии. Думаю, так я отдаю свой долг городу, который воспитал меня как тренера.

Детских футбольных школ в стране очень мало. Раньше мы шли от массы к качеству, но это потеряно. И главная задача наших футбольных руководителей – сделать так, чтобы как можно больше детей имели условия для тренировок – поля, арены и т.д.Дело даже не в воспитании профессиональных игроков. Важно, чтобы любой из наших детей имел возможность заниматься спортом – неважно каким: футболом, лыжами, фигурным катанием.

Еще одна серьезная тема — очень большая потеря талантливой молодежи. Молодежная команда (до 17 лет) дважды становилась чемпионом Европы (под руководством Колыванов — в 2006 году и под руководством Хомухи — в 2013 году). Немногие из этих игроков смогли чего-то добиться позже, в частности — Александр-Головин … Причина? Посмотрите, во многих странах Европы регулярные соревнования для юношей длятся до 23 лет, а у нас они, по сути, заканчиваются в 17, когда ребята заканчивают футбольные школы. То есть 17-летние должны либо выступать в командах со старшими футболистами, либо переходить в дублирующие составы клубов премьер-лиги. Именно здесь пропадают многие талантливые ребята.

Будь то ЦСКА или сборная — к сожалению или к счастью, есть люди, которые сегодня гораздо глубже разбираются в этой теме.Есть действующие коучи, которые принимают решения и несут за них ответственность. Все мы, конечно, можем придумать что-то свое по любому вопросу — кого ставить в состав, кого — нет и т.д. Но знаете, очень легко иметь свою точку зрения, когда не отвечаешь для всего. Поэтому воздержусь от комментариев. Скажу лишь, что сборную нужно поддерживать вне зависимости от того, играют ли в обороне братья Березуцкие и Игнашевичи или Кутепов и Кудряшов.

Ткаченко футбольный агент. Девять ведущих российских футбольных агентов

У Германа Ткаченко столько разноплановых талантов, что не так-то просто ответить на вопрос, кто именно он. За свою карьеру он применял свои таланты в совершенно различных видах человеческой деятельности. Но наибольшую популярность он приобрел в футбольной сфере. Как агент многих талантливых футболистов России и Украины, он приобрел большой авторитет, особенно во время трансферных кампаний, проводимых командами.Герман Ткаченко, биография которого может довольно много рассказать о том, какой он человек и специалист, герой данной статьи.

Учеба и начало работы

Ткаченко Герман Владимирович родился в 1970 году в Донбассе. В то далекое советское время Донбасс входил в состав УССР, и был одним из самых благополучных регионов Украины. Биография юного Германа мало чем отличалась от биографий сотен тысяч молодых парней, окончивших в то время среднюю школу.После окончания школы Герман Ткаченко успешно поступает в Горловский государственный педагогический институт иностранных языков и заканчивает его. Он делает это настолько успешно, что его оставляют преподавать в том же институте. Отличное знание иностранного языка окажет большое влияние на дальнейшую трудовую деятельность Ткаченко.

В дальнейшем, закончив преподавательскую деятельность, тогда еще совсем молодой специалист Герман Ткаченко пробует себя на экономическом поприще, занимая несколько ответственных должностей в экономике Украины.И до 1999 года решает хозяйственные вопросы на различных предприятиях Украины, либо представляет интересы российских предприятий на этой территории. Но до этого времени особого интереса к футболу не проявлял. И его не видели в футбольных кругах. В это время больше проявляется его талант политика и хозяйственника.

Первые шаги в футболе вместе с самарскими «Крыльями Советов»

С 1999 года Герман Ткаченко делает свои первые шаги в российском футболе.Отныне он становится президентом футбольного клуба Премьер-лиги «Крылья Советов» из Самары. И в следующие шесть лет последовательно вникает в экономику клуба и России в целом. Именно в это время он приобретает огромный опыт управления этим хозяйством, который позволит ему в будущем вырасти до топ-менеджера российского футбола. Но и в это время он не прекращает своей продюсерской и политической деятельности. Именно в этот период он переехал в Россию и принял российское гражданство.А через два года был избран сенатором в Совет Федерации от Самарской области и следующие пять лет занимался политической деятельностью.

Футбольное агентство «ProSports Management»

В 2005 году, покончив с политической деятельностью, Герман Ткаченко решает сосредоточить свои усилия и применить полученный опыт в футбольной экономике страны. Создается российское представительство английской управляющей компании по организации спортивных мероприятий «ProSports Management».Здесь Герман Ткаченко занимает пост представительства. Именно в это время он начал представлять в качестве агента нескольких талантливых футболистов в чемпионатах России и Украины. Одним из плеяды таких спортсменов был Александр Алиев.

В дальнейшем Герман Ткаченко — футбольный агент (фото которого размещено выше), который представлял таких игроков, как Сергей Игнашевич и Андрей Ермоленко. Также услугами пользуются многие другие спортсмены, как лично Герман Ткаченко, так и компания ProSports.

Герман Ткаченко и Анжи Махачкала

Очередной, можно однозначно сказать, грандиозный проект, в котором к тому времени принимает участие уже известный футбольный агент, это возрождение Анжи Махачкала в 2011 году. Именно в это время у команды сменился владелец, и клуб стал тратить большие деньги, приглашая футболистов с мировым именем, совершая рекордные для того времени трансферы в России и по всему миру. А Герман Ткаченко стоял у истоков этого проекта и руководил приглашением и тренерством в «Анжи».

К таким замечательным именам можно отнести знаменитого голландского тренера Гуса Хиддинга, а из плеяды великих футболистов стоит отметить такие имена, как Роберто Карлос и Самуэль Это»о, и многих других известных личностей. Хотя со временем этот футбольный проект постепенно сворачивалась в том виде, в котором начиналась, и самые известные игроки тем не менее покидали команду из-за отсутствия финансирования, тем не менее, был получен бесценный опыт сотрудничества с игроками, имеющими мировое имя.И вот Герман Ткаченко, фото которого можно найти во многих спортивных журналах, занимает почетное место в тройке лучших футбольных агентов России.

Герман Ткаченко — футбольный аналитик

В настоящее время раскрывается еще один талант Германа Ткаченко. Каждый год в футбольном мире две трансферные кампании. И каждая команда старается проявлять свою активность именно в эти трансферные окна, в которые игроки могут переходить из команды в команду. Именно в это время любителям футбола требуется множество аналитических обзоров трансферной деятельности той или иной команды.И многие СМИ пользуются услугами Германа Ткаченко, который является не только опытным действующим агентом, но и специалистом, хорошо знающим не только российскую футбольную индустрию, но и мировую в целом.

Личная и общественная жизнь Германа Ткаченко

Если искать информацию о личной жизни такого футбольного агента, как Герман Ткаченко, достаточно часто публикуется биография с фото его, но кроме сообщений о том, что он женат, другую информацию найти довольно сложно.Со светской жизнью все проще и можно многому научиться. Так что в сети много фотографий с известными публичными личностями, такими как Тина Канделаки или Роман Абрамович. Герман ведет активную деятельность и можно найти довольно много фотографий, свидетельствующих об этом.

Жизнь Германа Ткаченко вне футбола

В настоящее время жизнь Германа в основном связана с футболом, и 46-летний агент и аналитик не видит себя вне этого вида спорта. Но мы видели, как много у этого человека талантов, и, может быть, в будущем он проявит себя в каком-то новом качестве.Не нужно загадывать наперед, время покажет, кем на самом деле является Герман Ткаченко: футбольным топ-менеджером, производственником или политиком. Время все расставит по своим местам.

1. Олег Артемов (Dr. Oliver Wendt & Tomas Zorn)
VIP клиенты: Андрей Аршавин, Роман Павлюченко, Павел Погребняк, Александр Самедов.

Олег Артемов получил агентскую лицензию в 2004 году, и с тех пор его клиентская база постоянно расширяется. А началось все с представления интересов спартаковского дублера Николая Абрамова.Из запаса красно-белых знает Павла Погребняка, которому позже помог оказаться в «Зените», а еще позже в Европе. Сейчас Артемов работает почти со всеми российскими «европейцами» — бывшими (Павлюченко) и нынешними

(Аршавин, Погребняк, Адамов). Кроме того, «Локомотив» можно назвать базовым клубом агента, где почти половина команды — его клиенты. В России Артемов представляет интересы немецкого агентства Dr. Oliver Wendt & Tomas Zorn, фигурировавшего в так называемом «деле Прядкина».

2. Павел Андреев (П.А.Ф.А)
VIP клиенты: Игорь Денисов, Владимир Быстров, Дмитрий Комбаров, Кирилл Комбаров, Антон Шунин, Александр Анюков.

Один из первых агентов российского рынка. Широкую известность он получил благодаря своему первому клиенту Дмитрию Сычеву, с которым работает и по сей день. Его интересы также были тесно связаны с «Зенитом» — Андреев сотрудничал с молодыми (на тот момент) игроками питерского клуба, ходил в школу. Аршавин тоже был его клиентом, но пути агента и футболиста разошлись, когда у Андрея появилось горячее желание уехать в Европу.Сейчас среди клиентов Андреева по-прежнему есть несколько руководителей «Зенита». Его самый авторитетный подопечный – Игорь Денисов.

3. ProSports Management ()
VIP клиенты: Александр Кержаков, Андрей Ярмоленко, Сергей Игнашевич, Александр Алиев.

Компания основана Германом Ткаченко еще в 2005 году и является одной из самых известных на российском рынке. Необходимый опыт управления футбольным бизнесом, связи и первых клиентов Ткаченко получил, на протяжении шести лет руководя самарскими «Крыльями».С тех пор он работал с Колодиным, Лейлтоном, ранее с Андреем Тихоновым, пока не завершил игровую карьеру. Помимо агентской деятельности, сейчас он занят амбициозным проектом под названием «Анжи» — будучи членом совета директоров клуба, занимается как селекцией, так и продвижением бренда. Среди клиентов его компании, в которой помимо самого Ткаченко работает еще несколько агентов, Александр Кержаков, Сергей Игнашевич и ряд известных украинских игроков.Из молодежи — Шатов и Логашов, Смолов и Юсупов.

4. Агентство «СА» (+)
VIP клиенты: Артем Дзюба, Владимир Гранат, Сергей Рыжиков, Георгий Щенников.

Агентство Алексея Сафонова сознательно ориентируется на молодых футболистов, хотя среди его клиентов есть и более опытные — Сергей Рыжиков, Алексей Медведев, Александр Харитонов. Что касается молодежи, то «СА» работает как с ближайшим резервом сборной России, так и с совсем юными и никому не известными игроками, делающими первые шаги в большом футболе.Неслучайно стратегическим партнером агентства является Чертановская школа.

5. ASA International (Арсен Минасов)
VIP клиенты: Роман Широков, Константин Зырянов, Владислав Кулик, Ведран Чорлука, Огнен Вукоевич.

Среди клиентов Минасова не так много российских звезд первой величины — Зырянова и Широкова. Однако ASA работает и на международном рынке, в первую очередь с хорватскими игроками. Услугами агентства пользуется Лука Модрич, а также два недавних новичка российской команды — «железнодорожники» Чорлука и Спартак Вукоевич.

6.
VIP клиенты: Андрей Воронин, Дмитрий Булыкин.

Украинский агент приехал в Россию не так давно, и список его подопечных в принципе не очень большой, но это очень известные футболисты. Самый именитый из его клиентов Андрей Воронин вскоре должен вернуться в премьер-лигу. А Дмитрий Булыкин не без помощи Головаша обрел в Европе вторую молодость.

7. Олег Яровинский (SPORT INVEST International)
VIP-клиенты: Марек Сухи, Мартин Йиранек, Ян Голенда.

Яровинский представляет на российском рынке международное агентство SPORT INVEST, основными клиентами которого являются чешские игроки, в том числе Петр Чех. Его подопечные в Премьер-лиге — Йиранек из «Терека», Суха из «Спартака» и Голанд из «Ростова». Другие чешские игроки

тех, кто приходит в российские клубы, тоже, скорее всего, станут клиентами Яровинского.

8. Виталий Калоев
VIP клиенты: Алексей Ионов, Антон Соснин.

Основная специализация Калоева – молодежный «Зенит».В последние годы она редко попадает в основной состав клуба, поэтому сейчас клиенты Виталия не играют в Санкт-Петербурге. Самые известные, Соснин и Ионов, находятся на Кубани. В свое время Калоев помог найти игровую практику Алану Касаеву.

9.
VIP-клиенты: Артем Милевский, Иван Соловьев.

Репутация Лахтера весьма неоднозначна, а список его официальных клиентов на данный момент состоит из двух имен. При этом сам стиль работы Дениса на российском рынке именно такой – пришел, предоставил трансфер и уехал.У Аршавина и Алиева остались о нем не самые лучшие воспоминания, но Лахтер помог первому перейти в «Арсенал», второму — в «Локомотив». Последнее его громкое достижение – переход молодого дарования Ивана Соловьева из «Динамо» в «Зенит» на правах свободного агента.

Для агентов российских игроков настали тяжелые времена. Приходится сдерживать не только нападки президента РФС, но и вести непростые переговоры с клубами — контракты многих игроков истекают через полгода, а команды настаивают на пересмотре долларовых зарплат в более мягкую ставку.Еженедельник «Футбол» выяснил, какие компании управляют игроками отечественных топ-клубов, какие агенты контролируют молодежные составы «Спартака» и ЦСКА и какая компания сейчас является самой влиятельной в российском футболе.

(чтобы увидеть таблицу в лучшем качестве, откройте фото в отдельной вкладке)

«Спартак»

Ближайшим к «Спартаку» агентом считается Алексей Сафонов (SA-Football Agency). Помимо большей части русскоязычного состава «Спартака», агентство Сафонова ведет почти всех молодых красно-белых игроков из академии и молодежной сборной.Также агентство активно сотрудничает с Чертановской школой.

Алексей Сафонов окончил футбольную школу ЦСКА, затем работал на Крайнем Севере, работал в Химках и Сатурне. Еще до того, как стать агентом, он подвергся ограблению на даче. По его словам, он получил почти триста ударов по лицу резиновой киянкой. После этого голова так распухла, что не помещалась на подушке.

Сафонов начал карьеру агента у Алексея Медведева, которого он вел на протяжении всей своей карьеры и в итоге увидел в футболке «Рубина» в матче против «Барселоны».Рядом с Сафоновым Сергей Рыжиков из четвертого вратаря «Сатурна» превратился во вратаря сборной. Алексей также работал с Артемом Дзюбой, и сейчас его агентство является одним из крупнейших в России и представляет интересы нескольких десятков футболистов.

Алексей Сафонов считается самым открытым агентом среди тех, кто руководит игроками Премьер-лиги. Широкому кругу людей он стал известен после того, как завел твиттер и стал вести там активную жизнь.Анекдоты, исторические фотографии и обсуждение футбола – всем этим Алексей развлекал подписчиков перед началом агентурной войны против РФС. После этого к шуткам добавился постоянный троллинг Николая Толстых: Сафонов отзывается о нем резко, но относительно корректно.

По словам Сафонова, игроки с маленькой зарплатой не платят ему 10-процентную комиссию, а с такими клиентами, как Алексей Медведев или Сергей Рыжиков, он даже контракты не подписывает — все на УДО.

Из других агентов, которые работают со спартаковскими игроками, стоит отметить Дмитрия Градиленко — в некоторых базах данных комментатор до сих пор числится агентом Жано Ананидзе. Также выделим компанию Европейское спортивное агентство : несмотря на европейское название, дела армянских легионеров Мовсисяна и Озбилиза ведутся Валерий Оганесян . Считается, что он близок к одному из основных акционеров «Спартака» Джевану Челоянцу.

Кроме того, стоит отметить, что дела Артема Дзюбы, по официальной версии, вел его отец.Но некоторые источники указывают, что Олег Артемов якобы продолжает консультировать форварда, и это усложняет процесс переговоров с Леонидом Федуном.

«Локомотив»

Большинство игроков «Локомотива» возглавляет компания Dr. Oliver Wendt & Tomas Zorn и Олег Артемов . В 2011 году, в разгар аппаратных войн вокруг РФС, «Новая газета» опубликовала расследование, в котором, ссылаясь на немецкие источники, назвала Томаса Цорна сыном президента РФПЛ Сергея Прядкина.Утверждалось, что гражданской женой президента РФПЛ была Елена Цорн, проживающая в Берлине, у которой есть сын Томас 1986 года рождения, а Сергей Прядкин довольно много времени провел в Германии.

Вот он вместе с известным агентом Константином Сарсанией учредил компанию GiRRus, которая вела дела таких игроков, как Роман Павлюченко, Александр Бухаров, Марат Измайлов, Александр Самедов, Дмитрий Тарасов, Дмитрий Торбинский и др… Адвокат Оливер Вендт, агент ФИФА Томас Цорн и российский агент Олег Артемов.При их посредничестве, в частности, в московское «Динамо» был переведен Кевин Кураньи.

Дело о возможной причастности президента Премьер-лиги к агентскому бизнесу и конфликте интересов дошло до спортивного суда Лозанны и там через 2,5 года было закрыто. В то же время исчезла компания GiRRus, но осталась компания Dr. Oliver Wendt & Tomas Zorn. Сейчас ее клиентами являются более 50 футболистов. Три четверти из них связаны с российскими клубами.Единственный известный иностранный футболист — шотландский нападающий «Сандерленда» Стивен Флетчер.

Среди клиентов Dr. Oliver Wendt & Tomas Zorn можно найти практически всех футболистов GiRRus. Кстати, в российских базах данных часто указывается, что их агентом является Олег Артемов, которого считают представителем немецкой компании в России. С этим обстоятельством принято связывать возможность появления Артема Дзюбы в «Локомотиве».

футболиста во главе с Dr.Оливер Вендт и Томас Цорн составляют не только костяк «Локомотива» (к ним можно добавить Виталия Денисова): в «Ростове» их много, а в «Рубине» достаточно. В «Локомотиве» можно встретить практически всех ведущих агентов России и международных фирм. Но обращает на себя внимание обилие клиентов ProSports Management Германа Ткаченко .

«Динамо»

Агент Игоря Денисова, одного из самых сложных динамовцев, Павел Андреев (П.А.Ф.А. агентство). Среди клиентов Андреева много петербургских игроков, которых он взял под свое крыло в юности. А в российский футбол шумно ворвался Павел Андреев. Когда профессия агента только формировалась, он взял под крыло самого талантливого игрока того времени – Дмитрия Сычева. Об Андрееве никто бы и не узнал, если бы не конфликт между нападающим и «Спартаком». Несмотря на все трудности, агентство P.A.F.A до сих пор сотрудничает с Сычевым.Уже более десяти лет, хотя сам футболист почти не сотрудничает с футболом.

Долгое время P.A.F.A. представляла интересы Андрея Аршавина, но союз распался во время сериала «Как перейти в лондонский Арсенал?». Игроки Андреева вообще сложные персонажи. Один из них – Владимир Быстров, решившийся на рискованный маневр Петербург-Москва-Петербург. «Не было возможности спасти Быстрова. У Володи есть агент — Павел Андреев, и все агенты составляют контракт так, чтобы получать как можно больше на протяжении всей карьеры игрока», — объяснил ситуацию Леонид Федун в интервью «СЭ».Еще один мятежный герой – Игорь Денисов. Именно Андрееву пришлось отвечать, когда футболист устроил дебош в «Зените» и перестал попадать в сборную.

В П.А.Ф.А. игроков всего 12, из них 10 представляют Премьер-лигу, двое играют в ФНЛ. Последний переход – Роман Воробьев сменил питерское «Динамо» на «Газовик». При этом с иностранцами Андреев не работает, потому что «у нас и так хватает проблем с российскими игроками», и строит центр в Подольске (слухи о близости к местным бизнесам сопровождают агента на протяжении всей карьеры).

У «Динамо» есть еще один игрок с петербургским прошлым и агент. Делами Алексея Ионова руководит Виталий Калоев , в списке клиентов которого в основном воспитанники «Зенита». Но ни один из них еще не стал игроком основного состава, и большинство из них перешли в другие российские клубы более низкого уровня. За это на агента в Питере обижаются: считается, например, что именно Калоев причастен к уходу Алана Касаева в «Рубин» и переправляет молодых игроков в «Аланию».

Один из агентов самого звездного игрока «Динамо» Матье Вальбуэна — Жан-Пьер Берн . Это знаковая фигура французского футбола. Всемирную известность он получил еще в 1993 году – именно Берн был генеральным директором «Марселя», когда этот клуб был уличен в подкупе соперника. Тем самым человеком, который перевел деньги, был Жан-Пьер Берне, за что он получил условный срок и пожизненную дисквалификацию, но после этого был амнистирован.

ЦСКА

ЦСКА Евгений Гинер крайне неохотно идет на сотрудничество с агентами, предпочитая решать вопросы напрямую с игроками.Тем не менее, делами лидера команды Сергея Игнашевича занимается одна из самых известных агентских фирм России. Prosports Management Герман Ткаченко . Помимо армейского защитника, самыми известными российскими клиентами компании являются игроки «Зенита» Александр Кержаков и Олег Шатов, игрок «Динамо» Артур Юсупов.

Герман Ткаченко больше известен как менеджер, руководивший трансферными кампаниями крупных футбольных проектов. В футбол пришел в 1999 году, когда занял руководящую должность в самарских «Крыльях Советов».Собраны «под ключ» бронзовые «Крылья»-2004 и «Анжи»-2013 (включая приглашение в команду Самюэля Это’О). Говоря об этом в интервью, он грешит частым употреблением англицизмов — вроде малобюджетная команда или тренер-зонтик. Выход Ткаченко из проектов обычно сопровождается скандалами и подозрениями в неаккуратном обращении с трансферным бюджетом. Известен своей дружбой с Андреем Тихоновым, дважды переходившим в самарский клуб.

Компания Prosports Management, с которой сотрудничают агенты Михаил Данилюк, Айрат Имамов, Кахор Муминов и Константин Нестеренко, была создана Германом Ткаченко в 2005 году.Представители компании имеют дело с большим количеством украинцев, среди которых нападающие «Днепра» Роман Зозуля и Евгений Селезнев, а также временно безработный Александр Алиев.

Компания

Ткаченко также представляет интересы младшего Кержакова. Персональной заслугой Муминова считается трудоустройство вратаря в нижегородской «Волге» вместе с исключенными из «Крыльев» Александром Белозёровым и Русланом Аджинджалом. Клуб оценил его посредничество в 500 000 долларов.Еще 200 тысяч евро агент Prosports Management получил, организовав, судя по всему, последний значительный в карьере Андрея Каряки переход — в ту же «Волгу».

Отдельным поводом для гордости компании является карьера Федора Смолова, которая продолжается, несмотря на репутацию клиента. Муминов готов часами защищать Федора, объясняя свои неудачи «протестантским» образом жизни роттердамцев и сообщая, что его игрок зарабатывает на «Урале» в 3,5 раза меньше, чем в «Динамо».

Менеджер Роман Еременко известен среди агентов игроков ЦСКА Марко Трабукки . Трабукки, имеющий итальянские корни, сначала занимался устройством российских хоккеистов в Европе, затем устроил Руслана Нигматуллина в Верону, привел Кавенаги в «Спартак», а сейчас считается главным специалистом по итальянскому рынку.

«Зенит»

Культовый футболист «Зенита» Андрей Аршавин утверждает, что на данный момент у него нет агента, но в большинстве баз указано, что он с ним работает Олег Артемов — Еще одна ключевая фигура на российском трансферном рынке.

Олег Артемов получил агентскую лицензию в 2004 году, но не любит рассказывать о том, как попал в этот бизнес. Он отвечает уклончиво: мол, сначала просто помог одному человеку, так и пошло. Как сообщает «Новая газета», этим человеком был Владлен Светиков. В 1990-х он перевез не один десяток россиян в Западную Европу, был спортивным директором ЦСКА, а после перехода Червиченко в «Спартак» освоился в красно-белом клубе. В частности, он подписал соглашение с Александром Павленко.

Возможно, именно близость к Светикову помогла Артемову стать агентом многих молодых спартаковцев. Так, клиентами Олега стали Роман Павлюченко, Павел Погребняк, Александр Самедов, Алексей Ребко. Со всеми из них он до сих пор сотрудничает, а с последними даже открыл бизнес. По словам той же Новой, Ребко, Артемов и Чеснаускис (еще один клиент Олега) являются учредителями предприятия, зарегистрированного на Николо-Хованском кладбище, которое занимается складской деятельностью.

Вокруг Артемова не раз возникали странные истории. В 2006 году переводом его клиента Погребняка на Тома заинтересовалась местная полиция. Томичи перечислил 400 тысяч долларов в качестве оплаты за услуги по поиску форварда на счет фирмы-однодневки. Прокуратура посчитала это откатом и возбудила уголовное дело. Однако некоторые агенты на условиях анонимности заявили, что Артемов тут ни при чем. Мол, переводом занимался его помощник, а де-факто старший бизнес-партнер Алексей Рыскин.В прошлом году деятельность Олега вновь проверила прокуратура. Инициатором выступил РФС, который активно борется с агентурой.

В конце года российский футбол всколыхнули слова Василия Уткина, который сообщил, что делами Артема Дзюбы занимается Андрей Червиченко. Экс-президент «Спартака» опроверг информацию, но на вопрос, знаком ли он с Рыскиным, сказал, что это его друг. Не секрет, что другом Червиченко является Светиков, чье агентство находится в его кабинете.Легко провести аналогию между Ребко, Самедовым, Павлюченко и Дзюбой. Звено Червиченко, Рыскина, Светикова и Артемова — тоже. Выводы напрашиваются сами собой. Но даже если делами Дзюбы фактически занимается его отец, для Артемова и Ко это не критично. По словам агента Олега Малежика, Олег Артемов — один из шести агентов, контролирующих 80% российского футбольного рынка.

Интересный агент и Халк. Совладельцем фирмы, которая ведет дела с самым дорогим легионером Российской премьер-лиги, является Вагнер Рибейро .Он также занимается карьерой Неймара, которого пытался устроить в «Реал Мадрид», и многими другими. бразильских звезд и постоянно дает скандальные комментарии. Но больше всего его фраза в Твиттере посвящена главному тренеру сборной Бразилии Луису Фелипе Сколари. «Он старый, заносчивый, отвратительный, тщеславный и глупый козел», — писал Вагнер после чемпионата мира. Больше Халк не вызывался в сборную Бразилии.

Текст: Андрей Вдовин, Александр Головин, Ярослав Кулемин, Вячеслав Опахин, Глеб Чернявский

Фото: Сергей Дроняев, Максим Серегин, Football Weekly

Болельщикам может показаться, что футбольный мир прост и незатейлив — пришел тренер одной команды, посмотрел игроков других команд, выбрал понравившегося спортсмена, поторговался и приобрел.

Однако все гораздо сложнее. Отношения между клубом и игроком развиваются через ряд посредников, представляющих интересы игрока. Некоторые из агентов зарабатывают гораздо больше, чем игроки.

Например, в Бразилии агенты имеют право на свои средства покупать транспортный лист игрока или его часть, для дальнейших переговоров с клубами и получения огромной прибыли.

Агенты футболиста получают комиссию от его зарплаты, которая определяется индивидуально и составляет примерно 10% от гонорара.Игроки соглашаются на это, так как агенты — общительные и хитрые люди — способны договориться с клубом о высокой заработной плате. Сами спортсмены не всегда адекватно оценивают свои возможности и могут заключить невыгодный для себя контракт.

RSF не может влиять на отношения игроков с агентами, так как это личное дело каждого. Союз активно вмешивается в отношения между клубами и агентами и официально разместил на сайте рекомендации по работе агентов, то есть командам необходимо отказаться от заключения договоров с агентами и осуществления сделок по переходу спортсменов между российскими клубами.Члены комиссии, рассчитывая на не очень большой рынок России, считают, что клубы могут мирно договориться о трансфере игроков без посредников.

Такая ситуация возникла из-за того, что агенты в значительной степени влияют на переход спортсмена.

Ярким примером является следующая ситуация: футбольный агент обязуется обеспечить переход спортсмена из одной команды в другую, аргументируя это тем, что без него эта покупка не будет осуществлена.За свое «уговоры» агент требует цену, которая может даже превышать трансферную стоимость игрока.

Такая ситуация может привести к резкому удорожанию трансфера, если спортсменом заинтересовались сразу несколько клубов. Бонус агента в этом случае увеличивается многократно, так как переход игрока в клуб будет зависеть от его словесности.

Павел Андреев — один из самых влиятельных футбольных агентов России. Этот человек остается на втором плане, но список спортсменов, с которыми он сотрудничает, говорит о многом: Анюков, Быстров, братья Комбаровы, Шунин, Сычев и другие известные футболисты.Выплаты агентам не разглашаются, но заработок от трансфера стоит не меньше реальной стоимости игроков (например, трансфер братьев Комбаровых).

Аршавин при переходе из «Зенита» в «Арсенал» сменил своего дистрибьютора Павла Андреева на Денниса Лахтера , который также является известным в России агентом.

Герман Ткаченко владеет целой компанией, состоящей из нескольких агентов, клиентами которых являются: Кержаков, Игнашевич, Касаев, Смолов, Шатов, Семшов, Алиев, Алдонин.В этой конторе работает знаменитый капитан МСК «Спартак» Тихонов. Эксперты подсчитали, что трансфер одного Кержакова составляет примерно более 20 миллионов евро.

Олег Артемов — российский агент, тесно сотрудничающий с немецкой фирмой О. Вендта. С ним сотрудничают следующие игроки: Самедов, Павлюченко, Шишкин, Погребняк, Торбинский, Бухаров и другие. В Европе интересы футболистов представляет немецкая сторона, а в России — Олег Артемов.Суммарно стоимость всех игроков, которые сотрудничают с этой конторой и играют в Российской премьер-лиге, составляет более 50 миллионов евро. Каждый игрок отдает примерно 10% своей зарплаты агентам.

Алексей Сафронов и его компания работают с юными футболистами и считаются уважаемой компанией. С Сафроновым сотрудничают следующие игроки: Бурлак, Щенников, Гранат, Дзюба, Паршивлюк, Яковлев и другие. Огромных цифр здесь пока нет, но количество талантов впечатляет.

Становится все популярнее Агент Минасов Арсен и его фирма, которые работают с Широковым и Зыряновым. Кроме российских футболистов офис Минасова организует трансфер Чорлука и Вукоевича из Хорватии.

О заработке футбольных агентов помогает судить тот факт, что после перехода в «Челси» бывший агент Жиркова подал иск о возврате упущенной выгоды в размере около 100 млн рублей. Причина этого в том, что все решилось без его участия в передаче.

российских футболиста сегодня предпочитают агентов из-за рубежа, рассчитывая либо на переезд за границу, либо на порядочность агентов. Популярным является агентство Goalkick Sportmanagement, в котором работают международные футбольные агенты по всему миру. Эта компания работает с такими спортсменами, как Дзагоев, Акинфеев, Еременко, Жирков, Кокорин и известными футболистами Хуаном Мата, Санти Касорла и другими.

Борьба с агентами и их произволом, если они есть, дело правильное, но может получиться так, что у президента РФС появится могущественный противник, сохраняющий нейтралитет, — футбольные агенты.

В преддверии нового 2017 года Российский футбольный союз сделал агентам подарок, который нельзя назвать желанным. Само по себе стремление чиновников упорядочить деятельность этой категории граждан, привести ее в соответствие со стандартами ФИФА и УЕФА было крайне похвально. Только манипуляции с трансферами от этого не стали прозрачнее — скорее, они стали более мутными.

Правила

Статья 2 Положения РФС о работе с посредниками гласит: «Футболисты, тренеры и клубы вправе пользоваться услугами только аккредитованных РФС посредников при переводе (переводе) футболиста из одного клуба в другой, а также как при заключении (изменении, расторжении) трудового договора футболиста или тренера с клубом.

Разумеется, РФС не ограничился автозаменой — одно понятие (агент) на другое (посредник). Изменились и критерии регистрации и аттестации «бойцов невидимого фронта» от футбола. Желающие официально участвовать в трансферных операциях должны были получить аккредитацию. Не бесплатно. Единовременная выплата по высшей категории PRO (всего их три) составила 10 млн рублей и еще 3 – ежегодные, начиная со второго года.Для какого-нибудь олигарха мелочь, а для рядового работника агентского бизнеса — приличные деньги, порой неподъемные (попробуйте отбить).

В результате всего за год реестр зарегистрированных посредников РФС сократился более чем в пять раз — с 38 субъектов на начало 2017 года до семи в настоящее время. При этом большинство фамилий из текущего списка даже въедливому футбольному фанату ничего не скажут.

Реестр

Единственный из этой группы, который не нуждается в представлении, это Павел Андреев , агент с высоким авторитетом, обширными связями и огромной клиентской базой.Он получил аккредитацию РФС с символическим первым номером. Список лиц, с которыми у Андреева заключен договор, также внушает уважение. Три больших клуба (Спартак, Краснодар, Динамо) и около семи десятков игроков ( Зобнин , Д. Комбаров , Селихов , Миранчук …) — это только вершина пирамиды, построенной Павлом Олеговичем и его партнеры.

Аккредитация №2 принадлежит Вадиму Шпиневу . Ему доверено заниматься четырьмя клубами РПЛ («Зенит», «Спартак», «Локомотив», «Рубин») и 17 преимущественно молодыми футболистами.До недавнего времени Шпинёв позиционировался в СМИ как представитель Миранчуков. Странно, что в реестре посредников РФС — официальном документе — ни Алексей, ни Антон не числятся его подопечными. Самая известная здесь фамилия – Лысов.

В клиентах по адресу Юрий Зайцев находится половина команд чемпионата России и около 30 игроков. У Дмитрий Студеникин соответствующий столбец таблицы содержит только одну команду и пару фамилий.По Дарина Никитина , Олег Потаинов и Михаил Чибриков (последние два имеют категорию СубПРО) пока пусто, но за каждой цифрой стоит влиятельный выгодоприобретатель, который по тем или иным причинам не хочет появляются в документах. Ну или банально тратить время на бумажную рутину.

Де-юре только эта «великолепная семерка» может оказывать услуги футболистам, тренерам и клубам при заключении/продлении/расторжении контрактов.И только она имеет право на официальную комиссию от клубов. «Нелицензионные» таких привилегий лишены. Для них это большой, огромный минус.

Посредники без лицензии

Значит ли это, что остальные агенты и целые специализированные компании вдруг стали вне закона и теперь занимаются незаконным бизнесом? Нисколько. Не прикажете представиться агентами? Ладно, назовем себя консультантами, помощниками, советниками. От переименования профессии ее суть и актуальность не изменились.

Единственное, что было сокращено, это источники дохода. Посредники без лицензии теперь получают комиссию только от физических лиц — игроков, тренеров. Кто-то регистрируется в качестве ИП, аккуратно платит налог на прибыль и спит спокойно. Некоторым и бумаги не нужны — достаточно джентльменского соглашения.

Если раньше для выполнения своих функций агенту требовалась лицензия, то теперь репутация на первом месте. Футбольный мир тесен, информация распространяется быстро.У кого имидж лучше, к тому и идут. Это как в институте: сначала работаешь на имя, потом имя работает на тебя.

Процент

Благополучие агента зависит от многих факторов — «веса» в бизнесе, дара убеждения, порядочности клиентов. Посредник кровно заинтересован в том, чтобы выбить для своего клиента более крупный контракт, больший подписной бонус — из этих выплат формируется его собственное вознаграждение.

Типовой размер комиссии агентства в России составляет 10% от оклада.С подписным бонусом вы можете претендовать на более солидный джекпот — до половины от общей суммы. В свою очередь размер подъемника определяет не только квалификацию, но и статус игрока. У свободного агента при прочих равных будет больше, чем у футболиста на контракте (бывшему работодателю платить не нужно). Этим объясняются частые задержки с продлением истекающих соглашений и скандальные переходы из одной команды в другую. Никто не хочет терять из-за этого качественных игроков, но многие не прочь получить их даром.

Грубо говоря, чем чаще игрок меняет локацию, тем сытнее живет его агент. Но эта схема работает только с топовыми игроками и заведомо ликвидной, талантливой молодежью. Как вы понимаете, за бездарность, особенно перезревшую, платить никто не будет (если, конечно, в деле нет явной коррупционной составляющей). Иногда агент даже отказывается от гонорара — лишь бы пристроить своего игрока.

Агенты со связями в мире СМИ предлагают клиентам более широкий спектр услуг, чем представительство на переговорах.Иногда они даже дают интервью под видом своих звездных, но неразговорчивых подопечных. Все бы ничего — слог иногда выдает…

Конфликт интересов

Агентский бизнес, как и любой крупный бизнес, циничен и порой жесток. Люди объединяются, расходятся, создают новые «кооперативы». Мигрируют и игроки — из команды в команду, из одной бизнес-группы в другую. Конфликты интересов неизбежны и время от времени вспыхивают.

В свое время при массовом исходе выжил один из самых опытных агентов страны.Вместе с бывшими партнерами Михаилом Череповским и Сергеем Пушкиным его «СА — футбольное агентство» оставило внушительный состав игроков. Индивидуальные переходы от одного представителя к другому происходят массово и воспринимаются как должное.

точек входа

«Залетному» агенту, даже если он хоть сто раз док на своем поле, в одиночку «вывести» игрока в РПЛ практически невозможно. Во-первых, менеджеры с правом подписи предпочитают работать с проверенными партнерами — слишком высок процент балаболов и обычных мошенников в этом мире.Во-вторых, в серьезных клубах со стабильным финансированием, как правило, нет единого «входа». Кандидата нужно утвердить на нескольких уровнях — от главного тренера до спортивного, генерального директора, президента. И на каждом он может быть зарублен. Я уже молчу о том, что у директора, осваивающего бюджетные средства, в сделке может быть свой интерес — не обязательно спортивный…

Перспективнее «войти» в крупный, амбициозный клуб с комплексом вертикаль власти сразу с нескольких сторон.В идеале — при поддержке коллег, имеющих влияние на конкретных функционеров (яркий пример — Марко Трабукки в «Спартаке»). В особо сложные истории включается целый пул агентов (3, 4, 5 человек), и каждый получает свой процент — если совместная операция пройдет успешно. Это временные союзы: заработали — и разошлись.

Фото: Александр Сафонов, «Чемпионат»

Редкий пример самодержавия в РПЛ — ЦСКА. Старшего поколения «солдат» и агентов не существовало. Березуцкий , Игнашевич или Акинфеев напрямую, без посредников, вели диалог по договорным вопросам с клубом — в лице спортивного или генерального директора, а резолюцию выносил президент Гинер .

То же самое касается переводов. Ни одно кадровое решение невозможно без ведома первого лица ЦСКА. От него ценные игроки не уходят к конкурентам, тем более бесплатно. Он никогда не переплачивает и обладает редким даром убеждения.За принципиальность и расчетливость Евгений Леннорович не пользуется большой популярностью в агентском сообществе. Но уважают.

Родственные агенты

В свете последних событий в СМИ чаще обычного мелькали имена отчима Александра Кокорина и отца Павла Мамаева . Оба фигурируют в новостях как агенты футболистов, провинившихся. Информированные люди уточнили: это определение не совсем корректно. Вернее, полуправда.

Константин Мамаев , а также любой другой родственник футболиста имеет право участвовать в обсуждении договорных нюансов с работодателем (для этого у игрока может не хватать решимости, опыта, элементарных знаний) или давать комментарии В прессе. В Клаудио Маркизио Допустим, отец выполняет аналогичные функции. Но карьерный рост игрока сопровождают другие люди. По одной из версий, переехать в Краснодар ему помог Герман Ткаченко.По другой, трансфер готовился и осуществлялся клубами напрямую, без участия посредников, и игроку оставалось только согласовать финансовые условия. Здесь ему, безусловно, понадобилась помощь отца.

Отчим играет аналогичную роль в карьере Кокорина Кирилл Логинов . По моим сведениям, двойной перевод Жирков и Кокорина из административной столицы в культурную был согласован без посторонней помощи, на высшем уровне.Представитель игрока подключился еще на этапе обсуждения личного контракта.

Папа представляет интересы Артем Дзюба , пожалуй, самый яркий российский футболист лета-осени-2018. Естественно, посредники, в том числе иностранные, всегда крутятся вокруг такой фигуры, заметной во всех отношениях. Все стремятся заработать на звезде — а по меркам РПЛ Дзюба — звезда без оговорок. Артем дал добро агентам на поиски клуба за границей и очень расстроился, когда они не увенчались успехом.В настоящее время Дзюба не связан договорными обязательствами ни с одним посредником. Трудно представить, что Артем подписывает какие-то договоры с собственным отцом.

Как показывает практика, футболистам такого статуса чаще требуется помощь сильного юриста, чем агента, вне зависимости от недавней истории. Топ-игроку России не составит труда найти команду — важно правильно оформить контракт.

Самые влиятельные агенты России

Составлять сейчас объективный рейтинг лучших агентов страны — безнадежное дело.Слишком много критериев оценки нужно учитывать — при том, что колоссального пласта информации в открытом доступе нет. Слухов и домыслов больше, чем достоверной информации. Но футбольные люди, с которыми я советовался при подготовке публикации, неизменно называли три фамилии (в алфавитном порядке): Андреев, Артемов, Ткаченко. Это «фронтмены», «лица» своих компаний или бизнес-групп.

Топ-9 самых влиятельных агентов России

Павел Андреев — «Посредник №1″1» по номеру лицензии. Официальных ресурсов его компании в Сети найти не удалось, но информация о трансфермаркте красноречиво дополняет картину реестра РФС. По их данным, только в основных командах «Спартак», «Локомотив» и «Динамо». 16 его клиентов (7 — 5 — 4), не считая «фармы», «молодежки», академии. ни ресурса, ни ссылок на трансфермаркт — все подчищено.Видимо, необходимость в пиаре окончательно отпала. Сослуживцы шутили, что у Артемова монополия на всех русскоязычных злоумышленников ростом от 185 см и выше. Сегодня многие из них либо ушли на пенсию ( Павлюченко ), либо недалеко от финиша ( Погребняк , Бухаров ), но, по слухам, клиентская база Артемова исчисляется сотнями имен.

Герман Ткаченко как он специализировался на звездах ( Тихонов , Игнашевич , Семак , А.Кержаков ), и специализируется. Сегодня «лица» Prosports Management: Федор Смолов , Олег Шатов , Артур Юсупов . В Интернете, что характерно, он также не представлен корпоративным сайтом. Судя по всему, одних и тех же слухов достаточно для поддержания высокого авторитета компании.

Некоторые воротилы трансферного рынка занимают высокие административные должности в клубах. Спортивный директор «Ростов» Алексей Рыскин если и упоминается в прессе (а это случается крайне редко), то, как правило, в связке с Артемовым, как давний деловой партнер агента и негласный лидер группы .

Рустем Сайманов чуть чаще появляется в публичном пространстве — должность (гендиректор «Рубина») обязывает. Казань обязана этому человеку историческим, первым чемпионством, пожалуй, не меньше, чем у Бердыева . Он фактически собрал золотую команду 10 лет назад. С тех пор авторитет Сайманов в футбольном мире только рос и укреплялся. Даже заключение его не смутило. Назначение на ключевую должность в «Рубине» — лучшее тому подтверждение.

Наряду с публичными и теневыми лидерами рынка есть компании, стремящиеся к открытости в бизнесе. Например, агентство D-Sports, которое занимается Александрой Ерохиной , Станиславом Крицюком , Евгенией Марковой и еще несколькими десятками молодых игроков, активно продвигает себя в Интернете через сайт, социальные сети. Но это скорее исключение из правил. В глобальном масштабе территория давно поделена, и тем, кто ее контролирует, незачем выходить из комфортной тени.Процесс налажен, деньги идут.

Охота за талантами

«В «Спартаке» или ЦСКА 2002-03 годов рождения уже сложно найти игрока без агента», — записка специалиста по детско-юношескому футболу, пожелавшего остаться неизвестным. — «Подними» быстро. Приглашают в рестораны, дарят айфоны, «подгоняют» контракты с производителями обуви, дают деньги родителям — все для того, чтобы завоевать и удержать перспективного мальчика. Сходите на матч 15-16-летних в Москву, посмотрите, кто их встречает — толпы длинноногих накрашенных девчонок в мини-юбках и дяденьки-агенты.И те, и другие охотятся — каждый свое…»

Как академии переманивают учеников друг у друга — тема для отдельного исследования…

13 футбольных друзей

«Чемпионат.com» составил свой вариант хит-парада самых богатых и влиятельных агентов и агентств мира.

.

Добавить комментарий

Ваш адрес email не будет опубликован.